Incidental Mutation 'RF054:Gabre'
ID605220
Institutional Source Beutler Lab
Gene Symbol Gabre
Ensembl Gene ENSMUSG00000031340
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit epsilon
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF054 (G1)
Quality Score214.458
Status Not validated
ChromosomeX
Chromosomal Location72255999-72274803 bp(-) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) TCAGGCTCAGGCT to TCAGGCTCAGGCTCAGGCT at 72270416 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064780]
Predicted Effect probably benign
Transcript: ENSMUST00000064780
SMART Domains Protein: ENSMUSP00000066543
Gene: ENSMUSG00000031340

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 40 55 N/A INTRINSIC
low complexity region 83 169 N/A INTRINSIC
low complexity region 173 219 N/A INTRINSIC
low complexity region 234 441 N/A INTRINSIC
Pfam:Neur_chan_LBD 482 688 1.4e-47 PFAM
Pfam:Neur_chan_memb 695 856 2.1e-23 PFAM
transmembrane domain 892 914 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 CGGC CGGCGGAGGC 18: 36,560,929 probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Dmkn GAAGTGGTGGAAGTGGTGG GAAGTGGTGGAAGTGGTGGAAGTGGTGTAAGTGGTGGAAGTGGTGG 7: 30,767,188 probably benign Het
Dnmt1 CCTCGTT CCTCGTTTTGGGGGCGGAGCACAGTTCCTAGCTCGTT 9: 20,910,139 probably null Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,299,938 probably benign Het
Gm8369 GTGT GTGTCTGT 19: 11,511,764 probably null Het
Lce1m CAC CACCGCTGCGGCGAC 3: 93,018,298 probably benign Het
Lrmp ATTG ATTGAGCACTTTG 6: 145,173,788 probably benign Het
Lypd8 TC TCGCCTCTGTTACCCCACAAATCACCAACACCTCCCCC 11: 58,390,251 probably benign Het
Nefh GGGACT GGGACTGGGCCTCACCTGCGGACT 11: 4,941,048 probably benign Het
Prp2 CTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCT C 6: 132,600,521 probably null Het
Rassf6 TCACTCATGGTCCTGTAGAGCAATGGGGATTC TCACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCCCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,911 probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,608,924 probably benign Het
Rassf6 CAATGGGGATTC CAATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGAAATGGGGATTC 5: 90,608,931 probably benign Het
Sbp GATGCTGACAACAAA GATGCTGACAACAAATATGCTGACAACAAA 17: 23,945,371 probably benign Het
Six3 GCG GCGCCG 17: 85,621,355 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Thbs1 TGACCTTAG TG 2: 118,122,865 probably benign Het
Tob1 GCA GCACCA 11: 94,214,461 probably benign Het
Ubqln3 AACAC A 7: 104,141,178 probably null Het
Zfhx3 AACAGCAGC AACAGCAGCCACAGCAGC 8: 108,956,096 probably benign Het
Other mutations in Gabre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Gabre APN X 72274653 nonsense probably null
FR4304:Gabre UTSW X 72270042 small insertion probably benign
FR4589:Gabre UTSW X 72270030 small insertion probably benign
FR4589:Gabre UTSW X 72270042 small insertion probably benign
FR4976:Gabre UTSW X 72270418 small insertion probably benign
FR4976:Gabre UTSW X 72270422 small insertion probably benign
R7620:Gabre UTSW X 72270259 missense unknown
RF002:Gabre UTSW X 72270057 nonsense probably null
RF005:Gabre UTSW X 72270045 nonsense probably null
RF009:Gabre UTSW X 72270712 small deletion probably benign
RF009:Gabre UTSW X 72270713 small insertion probably benign
RF010:Gabre UTSW X 72270060 small insertion probably benign
RF013:Gabre UTSW X 72270416 small insertion probably benign
RF023:Gabre UTSW X 72270054 small insertion probably benign
RF024:Gabre UTSW X 72270177 frame shift probably null
RF028:Gabre UTSW X 72270763 small insertion probably benign
RF029:Gabre UTSW X 72270059 small insertion probably benign
RF034:Gabre UTSW X 72270762 small insertion probably benign
RF037:Gabre UTSW X 72270061 small insertion probably benign
RF041:Gabre UTSW X 72270049 small insertion probably benign
RF042:Gabre UTSW X 72270047 small insertion probably benign
RF043:Gabre UTSW X 72270048 small insertion probably benign
RF044:Gabre UTSW X 72270061 small insertion probably benign
RF045:Gabre UTSW X 72270045 small insertion probably benign
RF045:Gabre UTSW X 72270181 frame shift probably null
RF047:Gabre UTSW X 72270053 small insertion probably benign
RF047:Gabre UTSW X 72270765 nonsense probably null
RF049:Gabre UTSW X 72270277 frame shift probably null
RF050:Gabre UTSW X 72270741 nonsense probably null
RF051:Gabre UTSW X 72270049 small insertion probably benign
RF052:Gabre UTSW X 72270047 small insertion probably benign
RF055:Gabre UTSW X 72270177 frame shift probably null
RF058:Gabre UTSW X 72270063 small insertion probably benign
RF059:Gabre UTSW X 72270764 small insertion probably benign
RF061:Gabre UTSW X 72270048 small insertion probably benign
RF064:Gabre UTSW X 72270063 nonsense probably null
RF064:Gabre UTSW X 72270171 frame shift probably null
X0018:Gabre UTSW X 72270338 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGACTGGGGCTCTGATTTC -3'
(R):5'- GAACCTCAGCCTCAGCCTC -3'

Sequencing Primer
(F):5'- AGGTCCAGCTCCGACTC -3'
(R):5'- ACCTGAGCCTCAGCCTGATC -3'
Posted On2019-12-04