Incidental Mutation 'RF055:Cul1'
ID 605231
Institutional Source Beutler Lab
Gene Symbol Cul1
Ensembl Gene ENSMUSG00000029686
Gene Name cullin 1
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF055 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 47430516-47503078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 47494067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 460 (D460V)
Ref Sequence ENSEMBL: ENSMUSP00000031697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031697] [ENSMUST00000146200]
AlphaFold Q9WTX6
Predicted Effect probably damaging
Transcript: ENSMUST00000031697
AA Change: D460V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031697
Gene: ENSMUSG00000029686
AA Change: D460V

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-174 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Cullin_Nedd8 703 770 6.19e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146200
AA Change: D460V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122702
Gene: ENSMUSG00000029686
AA Change: D460V

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-176 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations accumulate cyclin E1 and exhibit arrested development and lethality around embryonic day 6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B430218F22Rik GGCGGCGGCGGCG GGCGGCGGCGGCGGCGGCG 13: 118,523,385 (GRCm39) probably benign Het
Bhlhb9 C T X: 134,791,239 (GRCm39) L484F possibly damaging Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Cyb5r4 CTGCCCAGGGATGTGACAGACACA CTGCCCAGGGATGTGACAGACACAATGCCCAGGGATGTGACAGACACA 9: 86,922,467 (GRCm39) probably benign Het
Cyb5r4 CT CTTCCCAGGGATGTGACAGACACATT 9: 86,922,491 (GRCm39) probably benign Het
Dmkn GTGGTGGAAGTGGTGG GTGGTGGAAGTGGTGGAAGTTGTGGAATTGGTGGAAGTGGTGG 7: 30,466,616 (GRCm39) probably benign Het
Dnmt1 CACAGTTCCTACCTCGTT CACAGTTCCTACCTCGTTTTGGGGGCGGAGAACAGTTCCTACCTCGTT 9: 20,821,424 (GRCm39) probably null Het
Dnmt1 CTACCTCGTT CTACCTCGTTTTGGGGGCGGAGCACAGTTCGTACCTCGTT 9: 20,821,432 (GRCm39) probably benign Het
Dnmt1 CCTACCTCGTT CCTACCTCGTTTTGGAGGCGGAGCACAGTTGCTACCTCGTT 9: 20,821,431 (GRCm39) probably null Het
Fam171b AGCAGC AGCAGCCGCAGC 2: 83,643,220 (GRCm39) probably benign Het
Gab3 TCT TCTGCT X: 74,043,593 (GRCm39) probably benign Het
Gab3 TTC TTCGTC X: 74,043,616 (GRCm39) probably benign Het
Gabre CAGGCTCA C X: 71,313,783 (GRCm39) probably null Het
Garin5a GAGGA GAGGAAGGCTGGATCCTGGATACCTGGGGCTGAGGTAGGA 7: 44,149,957 (GRCm39) probably null Het
Gm16519 AAGCAG AAGCAGCAG 17: 71,236,326 (GRCm39) probably benign Het
Gm8369 GTGT GTGTTTGT 19: 11,489,112 (GRCm39) probably null Het
Gucy2d CTGGG CTGGGGGTCGTGGG 7: 98,108,248 (GRCm39) probably benign Het
Irag2 CACATTG CACATTGAGTACATTG 6: 145,119,511 (GRCm39) probably benign Het
Ivl CTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,479,607 (GRCm39) probably benign Het
Kmt2c TG TGCTCTCG,TGCGG 5: 25,520,770 (GRCm39) probably benign Het
Krtap28-10 GCCACA GCCACATCCACA 1: 83,019,851 (GRCm39) probably benign Het
Krtap28-10 CACAGCCACAGCC CACAGCCACAGCCGCAACAGCCACAGCC 1: 83,019,991 (GRCm39) probably benign Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,019,983 (GRCm39) probably benign Het
Mamld1 CAG CAGGAG X: 70,162,443 (GRCm39) probably benign Het
Med12l GCA GCATCA 3: 59,183,404 (GRCm39) probably benign Het
Nefh CTCAGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTCAGCTGGGGACTTGGCCTCAGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,004 (GRCm39) probably benign Het
Nelfe AAGACAGAGACCGGGATCGAGACAGAGAC AAGACAGAGACCGGGATCGAGACAGAGACAGAGACCGGGATCGAGACAGAGAC 17: 35,073,038 (GRCm39) probably benign Het
Osmr CTTCT CTTCTTCT 15: 6,867,181 (GRCm39) probably benign Het
Pou3f1 GGCGGCAGCGGC GGCGGCAGCGGCAGCGGC 4: 124,551,589 (GRCm39) probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTTGTGGTGGT 7: 127,384,471 (GRCm39) probably benign Het
Sgo2b G A 8: 64,396,203 (GRCm39) R18C probably damaging Het
Spata31h1 AATG AATGTCAATG 10: 82,126,827 (GRCm39) probably benign Het
Spmap2l CGA CGAACCTCCCCAGTCCCGCAAGGCCAGTGA 5: 77,164,250 (GRCm39) probably benign Het
Stard8 GGA GGAAGA X: 98,110,126 (GRCm39) probably benign Het
Zscan18 GCTGGCTAGGCTCTTCCTGTTGGTTGGGTTGATCCTTCTGGCTAGGCTCTTCCTGTTGTTTGCATTGATCCTTCTGGCTAGGCTCTTCCTGTTGGTTGCATTGATCCTTCTGGCTAGGCTCTTCCTGTTGG GCTGGCTAGGCTCTTCCTGTTGTTTGCATTGATCCTTCTGGCTAGGCTCTTCCTGTTGGTTGCATTGATCCTTCTGGCTAGGCTCTTCCTGTTGG 7: 12,508,352 (GRCm39) probably benign Het
Other mutations in Cul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Cul1 APN 6 47,485,978 (GRCm39) missense probably benign
IGL02410:Cul1 APN 6 47,461,948 (GRCm39) missense probably damaging 1.00
IGL02458:Cul1 APN 6 47,502,542 (GRCm39) missense possibly damaging 0.91
IGL02490:Cul1 APN 6 47,491,820 (GRCm39) missense probably damaging 0.98
IGL03065:Cul1 APN 6 47,472,015 (GRCm39) missense probably damaging 1.00
IGL03387:Cul1 APN 6 47,478,143 (GRCm39) missense probably damaging 0.96
IGL02837:Cul1 UTSW 6 47,500,139 (GRCm39) missense probably benign 0.01
R0064:Cul1 UTSW 6 47,479,349 (GRCm39) splice site probably benign
R0064:Cul1 UTSW 6 47,479,349 (GRCm39) splice site probably benign
R0436:Cul1 UTSW 6 47,500,707 (GRCm39) missense probably benign 0.16
R0746:Cul1 UTSW 6 47,495,222 (GRCm39) splice site probably null
R1103:Cul1 UTSW 6 47,494,111 (GRCm39) missense probably benign 0.03
R1471:Cul1 UTSW 6 47,491,820 (GRCm39) missense probably damaging 0.98
R1746:Cul1 UTSW 6 47,485,179 (GRCm39) missense probably damaging 0.98
R1852:Cul1 UTSW 6 47,497,764 (GRCm39) missense probably damaging 0.99
R1858:Cul1 UTSW 6 47,502,458 (GRCm39) splice site probably null
R1937:Cul1 UTSW 6 47,485,289 (GRCm39) missense probably benign 0.19
R1964:Cul1 UTSW 6 47,479,505 (GRCm39) missense probably damaging 0.98
R2985:Cul1 UTSW 6 47,479,441 (GRCm39) missense probably damaging 1.00
R4452:Cul1 UTSW 6 47,485,923 (GRCm39) nonsense probably null
R4653:Cul1 UTSW 6 47,461,897 (GRCm39) missense probably damaging 1.00
R4860:Cul1 UTSW 6 47,494,080 (GRCm39) missense probably benign 0.38
R4860:Cul1 UTSW 6 47,494,080 (GRCm39) missense probably benign 0.38
R4860:Cul1 UTSW 6 47,494,125 (GRCm39) missense probably damaging 0.99
R4860:Cul1 UTSW 6 47,494,125 (GRCm39) missense probably damaging 0.99
R5141:Cul1 UTSW 6 47,497,773 (GRCm39) missense probably benign 0.04
R5328:Cul1 UTSW 6 47,485,251 (GRCm39) missense probably damaging 0.99
R5399:Cul1 UTSW 6 47,462,018 (GRCm39) splice site probably null
R5593:Cul1 UTSW 6 47,491,925 (GRCm39) missense probably damaging 0.99
R5593:Cul1 UTSW 6 47,462,020 (GRCm39) nonsense probably null
R5616:Cul1 UTSW 6 47,500,722 (GRCm39) missense probably damaging 1.00
R5855:Cul1 UTSW 6 47,500,147 (GRCm39) missense probably benign 0.00
R6382:Cul1 UTSW 6 47,479,373 (GRCm39) missense probably damaging 1.00
R6670:Cul1 UTSW 6 47,494,068 (GRCm39) missense probably damaging 1.00
R6964:Cul1 UTSW 6 47,493,443 (GRCm39) missense probably benign 0.01
R8146:Cul1 UTSW 6 47,472,027 (GRCm39) missense possibly damaging 0.50
R8373:Cul1 UTSW 6 47,491,997 (GRCm39) missense possibly damaging 0.78
R8842:Cul1 UTSW 6 47,492,010 (GRCm39) missense probably damaging 1.00
R8899:Cul1 UTSW 6 47,474,246 (GRCm39) missense possibly damaging 0.84
R9093:Cul1 UTSW 6 47,495,173 (GRCm39) missense probably damaging 1.00
R9352:Cul1 UTSW 6 47,479,426 (GRCm39) missense probably benign 0.00
RF001:Cul1 UTSW 6 47,501,515 (GRCm39) missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCTACTAAGTCTAGTCCAGTCAAC -3'
(R):5'- GAAAGCAGGTCTCACACTGC -3'

Sequencing Primer
(F):5'- AATGGATGGCGCTATTTATTGTGAAC -3'
(R):5'- GGTCTCACACTGCACGAAC -3'
Posted On 2019-12-04