Incidental Mutation 'RF055:Gm8369'
ID605250
Institutional Source Beutler Lab
Gene Symbol Gm8369
Ensembl Gene ENSMUSG00000058470
Gene Namepredicted gene 8369
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #RF055 (G1)
Quality Score197.468
Status Not validated
Chromosome19
Chromosomal Location11485938-11512577 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTGT to GTGTTTGT at 11511748 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079855] [ENSMUST00000163078] [ENSMUST00000186423] [ENSMUST00000188633]
Predicted Effect probably null
Transcript: ENSMUST00000079855
SMART Domains Protein: ENSMUSP00000132521
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163078
SMART Domains Protein: ENSMUSP00000124685
Gene: ENSMUSG00000024677

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186423
SMART Domains Protein: ENSMUSP00000140897
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 1 62 5.7e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000188633
SMART Domains Protein: ENSMUSP00000141067
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 2 48 3.7e-9 PFAM
low complexity region 130 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik AATG AATGTCAATG 10: 82,290,993 probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
B430218F22Rik GGCGGCGGCGGCG GGCGGCGGCGGCGGCGGCG 13: 118,386,849 probably benign Het
Bhlhb9 C T X: 135,890,490 L484F possibly damaging Het
Cul1 A T 6: 47,517,133 D460V probably damaging Het
Cyb5r4 CTGCCCAGGGATGTGACAGACACA CTGCCCAGGGATGTGACAGACACAATGCCCAGGGATGTGACAGACACA 9: 87,040,414 probably benign Het
Cyb5r4 CT CTTCCCAGGGATGTGACAGACACATT 9: 87,040,438 probably benign Het
Dmkn GTGGTGGAAGTGGTGG GTGGTGGAAGTGGTGGAAGTTGTGGAATTGGTGGAAGTGGTGG 7: 30,767,191 probably benign Het
Dnmt1 CACAGTTCCTACCTCGTT CACAGTTCCTACCTCGTTTTGGGGGCGGAGAACAGTTCCTACCTCGTT 9: 20,910,128 probably null Het
Dnmt1 CCTACCTCGTT CCTACCTCGTTTTGGAGGCGGAGCACAGTTGCTACCTCGTT 9: 20,910,135 probably null Het
Dnmt1 CTACCTCGTT CTACCTCGTTTTGGGGGCGGAGCACAGTTCGTACCTCGTT 9: 20,910,136 probably benign Het
Fam171b AGCAGC AGCAGCCGCAGC 2: 83,812,876 probably benign Het
Fam71e1 GAGGA GAGGAAGGCTGGATCCTGGATACCTGGGGCTGAGGTAGGA 7: 44,500,533 probably null Het
Gab3 TCT TCTGCT X: 74,999,987 probably benign Het
Gab3 TTC TTCGTC X: 75,000,010 probably benign Het
Gabre CAGGCTCA C X: 72,270,177 probably null Het
Gm16519 AAGCAG AAGCAGCAG 17: 70,929,331 probably benign Het
Gucy2d CTGGG CTGGGGGTCGTGGG 7: 98,459,041 probably benign Het
Ivl CTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,300 probably benign Het
Kmt2c TG TGCTCTCG,TGCGG 5: 25,315,772 probably benign Het
Krtap28-10 GCCACA GCCACATCCACA 1: 83,042,130 probably benign Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,262 probably benign Het
Krtap28-10 CACAGCCACAGCC CACAGCCACAGCCGCAACAGCCACAGCC 1: 83,042,270 probably benign Het
Lrmp CACATTG CACATTGAGTACATTG 6: 145,173,785 probably benign Het
Mamld1 CAG CAGGAG X: 71,118,837 probably benign Het
Med12l GCA GCATCA 3: 59,275,983 probably benign Het
Nefh CTCAGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTCAGCTGGGGACTTGGCCTCAGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,004 probably benign Het
Nelfe AAGACAGAGACCGGGATCGAGACAGAGAC AAGACAGAGACCGGGATCGAGACAGAGACAGAGACCGGGATCGAGACAGAGAC 17: 34,854,062 probably benign Het
Osmr CTTCT CTTCTTCT 15: 6,837,700 probably benign Het
Pou3f1 GGCGGCAGCGGC GGCGGCAGCGGCAGCGGC 4: 124,657,796 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTTGTGGTGGT 7: 127,785,299 probably benign Het
Sgo2b G A 8: 63,943,169 R18C probably damaging Het
Stard8 GGA GGAAGA X: 99,066,520 probably benign Het
Thegl CGA CGAACCTCCCCAGTCCCGCAAGGCCAGTGA 5: 77,016,403 probably benign Het
Zscan18 GCTGGCTAGGCTCTTCCTGTTGGTTGGGTTGATCCTTCTGGCTAGGCTCTTCCTGTTGTTTGCATTGATCCTTCTGGCTAGGCTCTTCCTGTTGGTTGCATTGATCCTTCTGGCTAGGCTCTTCCTGTTGG GCTGGCTAGGCTCTTCCTGTTGTTTGCATTGATCCTTCTGGCTAGGCTCTTCCTGTTGGTTGCATTGATCCTTCTGGCTAGGCTCTTCCTGTTGG 7: 12,774,425 probably benign Het
Other mutations in Gm8369
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1013:Gm8369 UTSW 19 11511783 frame shift probably null
R4192:Gm8369 UTSW 19 11502232 missense probably damaging 0.97
R5445:Gm8369 UTSW 19 11504806 missense possibly damaging 0.55
R5809:Gm8369 UTSW 19 11504884 intron probably benign
R6258:Gm8369 UTSW 19 11511609 missense possibly damaging 0.93
R6791:Gm8369 UTSW 19 11511836 unclassified probably benign
RF004:Gm8369 UTSW 19 11511754 small insertion probably benign
RF006:Gm8369 UTSW 19 11511764 small insertion probably benign
RF008:Gm8369 UTSW 19 11511754 frame shift probably null
RF016:Gm8369 UTSW 19 11511754 frame shift probably null
RF017:Gm8369 UTSW 19 11511742 frame shift probably null
RF018:Gm8369 UTSW 19 11511742 frame shift probably null
RF025:Gm8369 UTSW 19 11511773 frame shift probably null
RF028:Gm8369 UTSW 19 11511773 nonsense probably null
RF032:Gm8369 UTSW 19 11511778 small insertion probably benign
RF033:Gm8369 UTSW 19 11511778 small insertion probably benign
RF035:Gm8369 UTSW 19 11511773 small insertion probably benign
RF036:Gm8369 UTSW 19 11511778 small insertion probably benign
RF037:Gm8369 UTSW 19 11511782 small insertion probably benign
RF039:Gm8369 UTSW 19 11511758 small insertion probably benign
RF039:Gm8369 UTSW 19 11511782 small insertion probably benign
RF041:Gm8369 UTSW 19 11511758 small insertion probably benign
RF042:Gm8369 UTSW 19 11511773 frame shift probably null
RF042:Gm8369 UTSW 19 11511778 small insertion probably benign
RF054:Gm8369 UTSW 19 11511764 frame shift probably null
Z1176:Gm8369 UTSW 19 11511624 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACTGACTATACTGGGTGAC -3'
(R):5'- GCCAATTCAATGCCCTTTGTAC -3'

Sequencing Primer
(F):5'- CTGACTATACTGGGTGACTCAATGAC -3'
(R):5'- ATTCAATGCCCTTTGTACATTAAATG -3'
Posted On2019-12-04