Incidental Mutation 'RF055:Stard8'
ID605255
Institutional Source Beutler Lab
Gene Symbol Stard8
Ensembl Gene ENSMUSG00000031216
Gene NameSTART domain containing 8
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF055 (G1)
Quality Score164.468
Status Not validated
ChromosomeX
Chromosomal Location99003248-99074728 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GGA to GGAAGA at 99066520 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036606] [ENSMUST00000149999]
Predicted Effect probably benign
Transcript: ENSMUST00000036606
SMART Domains Protein: ENSMUSP00000044491
Gene: ENSMUSG00000031216

DomainStartEndE-ValueType
low complexity region 44 65 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 288 299 N/A INTRINSIC
coiled coil region 334 372 N/A INTRINSIC
low complexity region 396 417 N/A INTRINSIC
low complexity region 457 464 N/A INTRINSIC
RhoGAP 579 770 1.97e-56 SMART
START 814 1016 2.13e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149999
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of Rho GTPase activating proteins that contain a steroidogenic acute regulatory protein related lipid transfer domain. The encoded protein localizes to focal adhesions and may be involved in regulating cell morphology. This protein may also function as a tumor suppressor. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik AATG AATGTCAATG 10: 82,290,993 probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
B430218F22Rik GGCGGCGGCGGCG GGCGGCGGCGGCGGCGGCG 13: 118,386,849 probably benign Het
Bhlhb9 C T X: 135,890,490 L484F possibly damaging Het
Cul1 A T 6: 47,517,133 D460V probably damaging Het
Cyb5r4 CTGCCCAGGGATGTGACAGACACA CTGCCCAGGGATGTGACAGACACAATGCCCAGGGATGTGACAGACACA 9: 87,040,414 probably benign Het
Cyb5r4 CT CTTCCCAGGGATGTGACAGACACATT 9: 87,040,438 probably benign Het
Dmkn GTGGTGGAAGTGGTGG GTGGTGGAAGTGGTGGAAGTTGTGGAATTGGTGGAAGTGGTGG 7: 30,767,191 probably benign Het
Dnmt1 CACAGTTCCTACCTCGTT CACAGTTCCTACCTCGTTTTGGGGGCGGAGAACAGTTCCTACCTCGTT 9: 20,910,128 probably null Het
Dnmt1 CCTACCTCGTT CCTACCTCGTTTTGGAGGCGGAGCACAGTTGCTACCTCGTT 9: 20,910,135 probably null Het
Dnmt1 CTACCTCGTT CTACCTCGTTTTGGGGGCGGAGCACAGTTCGTACCTCGTT 9: 20,910,136 probably benign Het
Fam171b AGCAGC AGCAGCCGCAGC 2: 83,812,876 probably benign Het
Fam71e1 GAGGA GAGGAAGGCTGGATCCTGGATACCTGGGGCTGAGGTAGGA 7: 44,500,533 probably null Het
Gab3 TCT TCTGCT X: 74,999,987 probably benign Het
Gab3 TTC TTCGTC X: 75,000,010 probably benign Het
Gabre CAGGCTCA C X: 72,270,177 probably null Het
Gm16519 AAGCAG AAGCAGCAG 17: 70,929,331 probably benign Het
Gm8369 GTGT GTGTTTGT 19: 11,511,748 probably null Het
Gucy2d CTGGG CTGGGGGTCGTGGG 7: 98,459,041 probably benign Het
Ivl CTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,300 probably benign Het
Kmt2c TG TGCTCTCG,TGCGG 5: 25,315,772 probably benign Het
Krtap28-10 GCCACA GCCACATCCACA 1: 83,042,130 probably benign Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,262 probably benign Het
Krtap28-10 CACAGCCACAGCC CACAGCCACAGCCGCAACAGCCACAGCC 1: 83,042,270 probably benign Het
Lrmp CACATTG CACATTGAGTACATTG 6: 145,173,785 probably benign Het
Mamld1 CAG CAGGAG X: 71,118,837 probably benign Het
Med12l GCA GCATCA 3: 59,275,983 probably benign Het
Nefh CTCAGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTCAGCTGGGGACTTGGCCTCAGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,004 probably benign Het
Nelfe AAGACAGAGACCGGGATCGAGACAGAGAC AAGACAGAGACCGGGATCGAGACAGAGACAGAGACCGGGATCGAGACAGAGAC 17: 34,854,062 probably benign Het
Osmr CTTCT CTTCTTCT 15: 6,837,700 probably benign Het
Pou3f1 GGCGGCAGCGGC GGCGGCAGCGGCAGCGGC 4: 124,657,796 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTTGTGGTGGT 7: 127,785,299 probably benign Het
Sgo2b G A 8: 63,943,169 R18C probably damaging Het
Thegl CGA CGAACCTCCCCAGTCCCGCAAGGCCAGTGA 5: 77,016,403 probably benign Het
Zscan18 GCTGGCTAGGCTCTTCCTGTTGGTTGGGTTGATCCTTCTGGCTAGGCTCTTCCTGTTGTTTGCATTGATCCTTCTGGCTAGGCTCTTCCTGTTGGTTGCATTGATCCTTCTGGCTAGGCTCTTCCTGTTGG GCTGGCTAGGCTCTTCCTGTTGTTTGCATTGATCCTTCTGGCTAGGCTCTTCCTGTTGGTTGCATTGATCCTTCTGGCTAGGCTCTTCCTGTTGG 7: 12,774,425 probably benign Het
Other mutations in Stard8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Stard8 APN X 99069335 missense probably damaging 1.00
IGL01063:Stard8 APN X 99073088 missense probably damaging 1.00
FR4304:Stard8 UTSW X 99066505 unclassified probably benign
FR4976:Stard8 UTSW X 99066513 unclassified probably benign
FR4976:Stard8 UTSW X 99066525 unclassified probably benign
R4198:Stard8 UTSW X 99066508 unclassified probably benign
R4641:Stard8 UTSW X 99066508 unclassified probably benign
R8246:Stard8 UTSW X 99065964 missense probably benign
R8247:Stard8 UTSW X 99065964 missense probably benign
RF002:Stard8 UTSW X 99066515 nonsense probably null
RF010:Stard8 UTSW X 99066517 unclassified probably benign
RF043:Stard8 UTSW X 99066520 unclassified probably benign
RF043:Stard8 UTSW X 99066527 unclassified probably benign
RF051:Stard8 UTSW X 99066524 unclassified probably benign
RF063:Stard8 UTSW X 99066524 nonsense probably null
RF064:Stard8 UTSW X 99066527 nonsense probably null
X0004:Stard8 UTSW X 99066683 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CCTATACAGGCTGAAGCTGAG -3'
(R):5'- CTGCAGTCGAGTTAGCTTCTTG -3'

Sequencing Primer
(F):5'- GCTGAGGCTGAAGCTGAG -3'
(R):5'- AGCCTGTACCAATGGTTCGAC -3'
Posted On2019-12-04