Incidental Mutation 'RF056:Rbm28'
ID605269
Institutional Source Beutler Lab
Gene Symbol Rbm28
Ensembl Gene ENSMUSG00000029701
Gene NameRNA binding motif protein 28
Synonyms2810480G15Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #RF056 (G1)
Quality Score214.458
Status Not validated
Chromosome6
Chromosomal Location29123576-29165006 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGCAACACCTCTCACCTGGGGCAGAAGCA to AGCAACACCTCTCACCTGGGGCAGAAGCAACACCTCTCACCTGGGGCAGAAGCA at 29157053 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000007993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007993]
PDB Structure
Solution structure of RRM domain in RNA-binding protein 28 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000007993
SMART Domains Protein: ENSMUSP00000007993
Gene: ENSMUSG00000029701

DomainStartEndE-ValueType
RRM 5 76 3.51e-19 SMART
low complexity region 99 114 N/A INTRINSIC
RRM 115 187 4.52e-22 SMART
low complexity region 225 248 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
RRM 326 405 1.85e-18 SMART
RRM 478 566 5.46e-7 SMART
low complexity region 707 720 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a specific nucleolar component of the spliceosomal small nuclear ribonucleoprotein (snRNP)complexes . It specifically associates with U1, U2, U4, U5, and U6 small nuclear RNAs (snRNAs), possibly coordinating their transition through the nucleolus. Mutation in this gene causes alopecia, progressive neurological defects, and endocrinopathy (ANE syndrome), a pleiotropic and clinically heterogeneous disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Begain CG CGCCGCAG 12: 109,033,436 probably benign Het
Bhlhb9 C T X: 135,890,490 L484F possibly damaging Het
Cacna1f GA GAGTA X: 7,620,075 probably null Het
Chga GCA GCATCA 12: 102,561,424 probably benign Het
Cnpy3 CCT CCTACT 17: 46,736,744 probably null Het
Cyb5r4 CACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA CACACTGCCCAGGGATGTGACAGAGACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,410 probably benign Het
Dmkn T TAGAGGTGGAAGTGGTGGAAGTGGTGGA 7: 30,767,207 probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,767 probably benign Het
Fam171b C CAGCAGA 2: 83,812,896 probably benign Het
Fam71e1 CTGAGGGAGGA CTGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTATGAGGGAGGA 7: 44,500,527 probably null Het
Gm10181 GAGAGAGAGAGAGA G 9: 25,089,465 probably null Het
Gm16494 TTT TTTT 17: 47,016,915 probably null Het
Hsdl2 CCACAGCTGCAG CCACAGCTGCAGCAGCAGCACAGCTGCAG 4: 59,610,647 probably null Het
Med12l CAG CAGAAG 3: 59,275,993 probably benign Het
Nelfe A AGCGGGATCGAGACAGAGACAAAGG 17: 34,854,071 probably benign Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 TACACGTTAGCAGTGAGGAGCAAGCTGAGAC TACACGTTAGCAGTGAGGAGCAAGCTGAGACACACGTTAGCAGTGAGGAGCAAGCTGAGAC 2: 119,627,581 probably benign Het
Nusap1 GTTAGCAGTGAGGAGCAAGCTGAGA GTTAGCAGTGAGGAGCAAGCTGAGATACACTTTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,586 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGGAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Olfr964-ps1 A ATAGG 9: 39,686,754 probably null Het
Pdik1l TTGCACC TTGCACCTGCACC 4: 134,279,502 probably benign Het
Pdik1l C CCACCAA 4: 134,279,516 probably benign Het
Pqbp1 ACACACACACACC A X: 7,898,759 probably benign Het
Rnf126 GAGGAC G 10: 79,759,142 probably null Het
Rprd2 CAGAGCCTGTGGTGCTCGCAGG C 3: 95,766,319 probably benign Het
Rtbdn CGG CGGAAGAGG 8: 84,956,170 probably benign Het
Rtbdn GCAGCG GCAGCGCCAGCG 8: 84,956,172 probably benign Het
Sbp ACAAAGATGCTGACA ACAAAGATGCTGACAGCAAAGATGCTGACA 17: 23,945,366 probably benign Het
Setd1a GTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG GTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,303 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,328 probably benign Het
Sh3pxd2b CCTGTG CCTGTGGCTGTG 11: 32,423,055 probably benign Het
Taf1a CACGTTGAAGCTGTAGGTAAGTGAGACAGCGTTGAAGCTGTAGGTAAGTGAGACA CGCGTTGAAGCTGTAGGTAAGTGAGACA 1: 183,391,029 probably benign Het
Tcof1 TCCCCTTGGC TCCCCTTGGCTGCTGAGATGGGCACTTTCCTAGAGACCCCCTTGGC 18: 60,833,575 probably benign Het
Tsen2 CCAG CCAGCAG 6: 115,560,064 probably benign Het
Unc13b CAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CAGAGCCAGAGCCAGAGCAAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,359 probably benign Het
Zfp384 CCCAGGC CCCAGGCCCAGGGCCAGGC 6: 125,036,490 probably benign Het
Other mutations in Rbm28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Rbm28 APN 6 29128585 missense possibly damaging 0.94
IGL02097:Rbm28 APN 6 29138618 missense possibly damaging 0.82
IGL02814:Rbm28 APN 6 29159726 missense probably benign 0.34
IGL03212:Rbm28 APN 6 29131275 missense probably damaging 1.00
R0106:Rbm28 UTSW 6 29127803 missense probably benign
R0106:Rbm28 UTSW 6 29127803 missense probably benign
R0109:Rbm28 UTSW 6 29160105 missense probably benign 0.16
R0376:Rbm28 UTSW 6 29158928 splice site probably benign
R0654:Rbm28 UTSW 6 29128578 missense probably damaging 1.00
R0884:Rbm28 UTSW 6 29155154 missense possibly damaging 0.68
R1255:Rbm28 UTSW 6 29158247 missense probably damaging 1.00
R1367:Rbm28 UTSW 6 29137640 missense probably damaging 1.00
R1466:Rbm28 UTSW 6 29155017 splice site probably benign
R2277:Rbm28 UTSW 6 29135514 unclassified probably null
R3917:Rbm28 UTSW 6 29154789 missense probably benign 0.00
R4033:Rbm28 UTSW 6 29159669 missense probably damaging 0.99
R4421:Rbm28 UTSW 6 29154837 missense probably damaging 1.00
R4728:Rbm28 UTSW 6 29143592 missense probably damaging 1.00
R4740:Rbm28 UTSW 6 29125354 utr 3 prime probably benign
R4952:Rbm28 UTSW 6 29138598 missense probably damaging 1.00
R5378:Rbm28 UTSW 6 29128559 missense probably damaging 0.99
R5652:Rbm28 UTSW 6 29135409 missense probably damaging 1.00
R6578:Rbm28 UTSW 6 29137640 missense probably damaging 1.00
R7351:Rbm28 UTSW 6 29158880 missense probably benign
R7770:Rbm28 UTSW 6 29164628 unclassified probably benign
Z1176:Rbm28 UTSW 6 29128547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTATCTCCAGCCCAACATTCC -3'
(R):5'- AGAGGTGGCATTTCTCTGTC -3'

Sequencing Primer
(F):5'- CTGGTCTACATAGCAAATTCCAGGAG -3'
(R):5'- AGGTGGCATTTCTCTGTCTCCAC -3'
Posted On2019-12-04