Incidental Mutation 'RF056:Chga'
ID605284
Institutional Source Beutler Lab
Gene Symbol Chga
Ensembl Gene ENSMUSG00000021194
Gene Namechromogranin A
SynonymsChrA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #RF056 (G1)
Quality Score194.468
Status Not validated
Chromosome12
Chromosomal Location102554969-102565028 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GCA to GCATCA at 102561424 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021610]
Predicted Effect probably benign
Transcript: ENSMUST00000021610
SMART Domains Protein: ENSMUSP00000021610
Gene: ENSMUSG00000021194

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Granin 25 95 3e-26 PFAM
Pfam:Granin 87 463 1.7e-95 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the granin family of acidic secretory glycoproteins that are expressed in endocrine cells and neurons. The encoded preproprotein undergoes proteolytic processing to generate multiple functions peptides including pancreastatin, catestatin and serpinin. The encoded protein plays important roles in the neuroendocrine system including regulated secretion of peptide hormones and neurotransmitters. Mice lacking the encoded protein exhibit elevated blood pressure which can be rescued by transgenic expression of the human ortholog. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes and heterozygotes for one allele display hypertension, abnormal plasma and adrenal adrenaline and noradrenaline levels and, in homozygotes, partial embryonic lethality. Homozygotes for a second allele only have elevated urinary adrenaline, noradrenaline and dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Begain CG CGCCGCAG 12: 109,033,436 probably benign Het
Bhlhb9 C T X: 135,890,490 L484F possibly damaging Het
Cacna1f GA GAGTA X: 7,620,075 probably null Het
Cnpy3 CCT CCTACT 17: 46,736,744 probably null Het
Cyb5r4 CACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA CACACTGCCCAGGGATGTGACAGAGACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,410 probably benign Het
Dmkn T TAGAGGTGGAAGTGGTGGAAGTGGTGGA 7: 30,767,207 probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,767 probably benign Het
Fam171b C CAGCAGA 2: 83,812,896 probably benign Het
Fam71e1 CTGAGGGAGGA CTGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTATGAGGGAGGA 7: 44,500,527 probably null Het
Gm10181 GAGAGAGAGAGAGA G 9: 25,089,465 probably null Het
Gm16494 TTT TTTT 17: 47,016,915 probably null Het
Hsdl2 CCACAGCTGCAG CCACAGCTGCAGCAGCAGCACAGCTGCAG 4: 59,610,647 probably null Het
Med12l CAG CAGAAG 3: 59,275,993 probably benign Het
Nelfe A AGCGGGATCGAGACAGAGACAAAGG 17: 34,854,071 probably benign Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 TACACGTTAGCAGTGAGGAGCAAGCTGAGAC TACACGTTAGCAGTGAGGAGCAAGCTGAGACACACGTTAGCAGTGAGGAGCAAGCTGAGAC 2: 119,627,581 probably benign Het
Nusap1 GTTAGCAGTGAGGAGCAAGCTGAGA GTTAGCAGTGAGGAGCAAGCTGAGATACACTTTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,586 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGGAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Olfr964-ps1 A ATAGG 9: 39,686,754 probably null Het
Pdik1l TTGCACC TTGCACCTGCACC 4: 134,279,502 probably benign Het
Pdik1l C CCACCAA 4: 134,279,516 probably benign Het
Pqbp1 ACACACACACACC A X: 7,898,759 probably benign Het
Rbm28 AGCAACACCTCTCACCTGGGGCAGAAGCA AGCAACACCTCTCACCTGGGGCAGAAGCAACACCTCTCACCTGGGGCAGAAGCA 6: 29,157,053 probably null Het
Rnf126 GAGGAC G 10: 79,759,142 probably null Het
Rprd2 CAGAGCCTGTGGTGCTCGCAGG C 3: 95,766,319 probably benign Het
Rtbdn CGG CGGAAGAGG 8: 84,956,170 probably benign Het
Rtbdn GCAGCG GCAGCGCCAGCG 8: 84,956,172 probably benign Het
Sbp ACAAAGATGCTGACA ACAAAGATGCTGACAGCAAAGATGCTGACA 17: 23,945,366 probably benign Het
Setd1a GTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG GTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,303 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,328 probably benign Het
Sh3pxd2b CCTGTG CCTGTGGCTGTG 11: 32,423,055 probably benign Het
Taf1a CACGTTGAAGCTGTAGGTAAGTGAGACAGCGTTGAAGCTGTAGGTAAGTGAGACA CGCGTTGAAGCTGTAGGTAAGTGAGACA 1: 183,391,029 probably benign Het
Tcof1 TCCCCTTGGC TCCCCTTGGCTGCTGAGATGGGCACTTTCCTAGAGACCCCCTTGGC 18: 60,833,575 probably benign Het
Tsen2 CCAG CCAGCAG 6: 115,560,064 probably benign Het
Unc13b CAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CAGAGCCAGAGCCAGAGCAAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,359 probably benign Het
Zfp384 CCCAGGC CCCAGGCCCAGGGCCAGGC 6: 125,036,490 probably benign Het
Other mutations in Chga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chga APN 12 102562799 missense probably damaging 0.98
IGL02674:Chga APN 12 102562901 missense probably damaging 1.00
FR4589:Chga UTSW 12 102561402 small insertion probably benign
R0018:Chga UTSW 12 102558505 missense probably damaging 0.97
R0463:Chga UTSW 12 102562951 nonsense probably null
R1164:Chga UTSW 12 102563045 missense probably damaging 1.00
R1603:Chga UTSW 12 102564607 splice site probably null
R1727:Chga UTSW 12 102561437 missense possibly damaging 0.85
R1778:Chga UTSW 12 102561700 missense probably benign
R1800:Chga UTSW 12 102555905 missense probably damaging 0.99
R2071:Chga UTSW 12 102562863 missense probably damaging 1.00
R3415:Chga UTSW 12 102562784 missense probably benign 0.00
R3696:Chga UTSW 12 102561465 missense probably damaging 0.98
R5022:Chga UTSW 12 102562837 missense probably damaging 1.00
R5507:Chga UTSW 12 102562609 missense probably benign 0.39
R5959:Chga UTSW 12 102561855 missense probably benign
R7338:Chga UTSW 12 102562841 missense probably damaging 1.00
R7410:Chga UTSW 12 102562607 missense probably benign 0.00
R7694:Chga UTSW 12 102561347 missense probably benign 0.05
R8084:Chga UTSW 12 102562069 missense probably benign 0.29
R8211:Chga UTSW 12 102561419 missense possibly damaging 0.71
RF001:Chga UTSW 12 102561423 small insertion probably benign
RF002:Chga UTSW 12 102561421 small insertion probably benign
RF006:Chga UTSW 12 102561412 small insertion probably benign
RF009:Chga UTSW 12 102561420 small insertion probably benign
RF010:Chga UTSW 12 102561403 small insertion probably benign
RF014:Chga UTSW 12 102561393 small insertion probably benign
RF014:Chga UTSW 12 102561405 small insertion probably benign
RF015:Chga UTSW 12 102561420 small insertion probably benign
RF022:Chga UTSW 12 102561420 small insertion probably benign
RF033:Chga UTSW 12 102561396 small insertion probably benign
RF035:Chga UTSW 12 102561427 small insertion probably benign
RF044:Chga UTSW 12 102561396 small insertion probably benign
RF048:Chga UTSW 12 102561403 small insertion probably benign
RF048:Chga UTSW 12 102561421 small insertion probably benign
RF049:Chga UTSW 12 102561393 small insertion probably benign
RF052:Chga UTSW 12 102561416 small insertion probably benign
RF054:Chga UTSW 12 102561423 small insertion probably benign
RF058:Chga UTSW 12 102561416 small insertion probably benign
RF060:Chga UTSW 12 102561424 small insertion probably benign
RF061:Chga UTSW 12 102561413 small insertion probably benign
RF061:Chga UTSW 12 102561427 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATAGCTGAGAGCCTGTACCC -3'
(R):5'- CGTCTGCAAACACAAATGGATAG -3'

Sequencing Primer
(F):5'- CTCAAGGGAGGCCTTCAGTGTTAC -3'
(R):5'- TCCTGAGGCCAAGTTCAATG -3'
Posted On2019-12-04