Incidental Mutation 'RF056:Sbp'
ID605286
Institutional Source Beutler Lab
Gene Symbol Sbp
Ensembl Gene ENSMUSG00000024128
Gene Namespermine binding protein
Synonymsp25
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #RF056 (G1)
Quality Score217.468
Status Not validated
Chromosome17
Chromosomal Location23941672-23945607 bp(+) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) ACAAAGATGCTGACA to ACAAAGATGCTGACAGCAAAGATGCTGACA at 23945366 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024940] [ENSMUST00000181985] [ENSMUST00000182519] [ENSMUST00000182868] [ENSMUST00000183017] [ENSMUST00000183155] [ENSMUST00000183252]
Predicted Effect probably benign
Transcript: ENSMUST00000024940
SMART Domains Protein: ENSMUSP00000024940
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Jacalin 26 151 2.32e-15 SMART
low complexity region 161 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181985
SMART Domains Protein: ENSMUSP00000138422
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Jacalin 26 151 2.32e-15 SMART
low complexity region 161 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182519
SMART Domains Protein: ENSMUSP00000138338
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:Jacalin 26 87 3e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182868
SMART Domains Protein: ENSMUSP00000138491
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Jacalin 53 178 2.32e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183017
Predicted Effect probably benign
Transcript: ENSMUST00000183155
SMART Domains Protein: ENSMUSP00000138341
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Jacalin 26 151 2.32e-15 SMART
low complexity region 161 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183252
SMART Domains Protein: ENSMUSP00000138219
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Jacalin 26 151 2.32e-15 SMART
low complexity region 161 198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Begain CG CGCCGCAG 12: 109,033,436 probably benign Het
Bhlhb9 C T X: 135,890,490 L484F possibly damaging Het
Cacna1f GA GAGTA X: 7,620,075 probably null Het
Chga GCA GCATCA 12: 102,561,424 probably benign Het
Cnpy3 CCT CCTACT 17: 46,736,744 probably null Het
Cyb5r4 CACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA CACACTGCCCAGGGATGTGACAGAGACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,410 probably benign Het
Dmkn T TAGAGGTGGAAGTGGTGGAAGTGGTGGA 7: 30,767,207 probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,767 probably benign Het
Fam171b C CAGCAGA 2: 83,812,896 probably benign Het
Fam71e1 CTGAGGGAGGA CTGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTATGAGGGAGGA 7: 44,500,527 probably null Het
Gm10181 GAGAGAGAGAGAGA G 9: 25,089,465 probably null Het
Gm16494 TTT TTTT 17: 47,016,915 probably null Het
Hsdl2 CCACAGCTGCAG CCACAGCTGCAGCAGCAGCACAGCTGCAG 4: 59,610,647 probably null Het
Med12l CAG CAGAAG 3: 59,275,993 probably benign Het
Nelfe A AGCGGGATCGAGACAGAGACAAAGG 17: 34,854,071 probably benign Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 TACACGTTAGCAGTGAGGAGCAAGCTGAGAC TACACGTTAGCAGTGAGGAGCAAGCTGAGACACACGTTAGCAGTGAGGAGCAAGCTGAGAC 2: 119,627,581 probably benign Het
Nusap1 GTTAGCAGTGAGGAGCAAGCTGAGA GTTAGCAGTGAGGAGCAAGCTGAGATACACTTTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,586 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGGAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Olfr964-ps1 A ATAGG 9: 39,686,754 probably null Het
Pdik1l TTGCACC TTGCACCTGCACC 4: 134,279,502 probably benign Het
Pdik1l C CCACCAA 4: 134,279,516 probably benign Het
Pqbp1 ACACACACACACC A X: 7,898,759 probably benign Het
Rbm28 AGCAACACCTCTCACCTGGGGCAGAAGCA AGCAACACCTCTCACCTGGGGCAGAAGCAACACCTCTCACCTGGGGCAGAAGCA 6: 29,157,053 probably null Het
Rnf126 GAGGAC G 10: 79,759,142 probably null Het
Rprd2 CAGAGCCTGTGGTGCTCGCAGG C 3: 95,766,319 probably benign Het
Rtbdn CGG CGGAAGAGG 8: 84,956,170 probably benign Het
Rtbdn GCAGCG GCAGCGCCAGCG 8: 84,956,172 probably benign Het
Setd1a GTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG GTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,303 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,328 probably benign Het
Sh3pxd2b CCTGTG CCTGTGGCTGTG 11: 32,423,055 probably benign Het
Taf1a CACGTTGAAGCTGTAGGTAAGTGAGACAGCGTTGAAGCTGTAGGTAAGTGAGACA CGCGTTGAAGCTGTAGGTAAGTGAGACA 1: 183,391,029 probably benign Het
Tcof1 TCCCCTTGGC TCCCCTTGGCTGCTGAGATGGGCACTTTCCTAGAGACCCCCTTGGC 18: 60,833,575 probably benign Het
Tsen2 CCAG CCAGCAG 6: 115,560,064 probably benign Het
Unc13b CAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CAGAGCCAGAGCCAGAGCAAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,359 probably benign Het
Zfp384 CCCAGGC CCCAGGCCCAGGGCCAGGC 6: 125,036,490 probably benign Het
Other mutations in Sbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Sbp APN 17 23945348 utr 3 prime probably benign
IGL02035:Sbp APN 17 23942612 missense possibly damaging 0.73
FR4449:Sbp UTSW 17 23945364 small insertion probably benign
FR4737:Sbp UTSW 17 23945382 small insertion probably benign
FR4737:Sbp UTSW 17 23945389 small insertion probably benign
R0457:Sbp UTSW 17 23945312 missense probably benign 0.04
R1083:Sbp UTSW 17 23942730 splice site probably benign
R1544:Sbp UTSW 17 23945069 missense probably benign 0.01
R2075:Sbp UTSW 17 23945158 splice site probably null
R3741:Sbp UTSW 17 23945582 utr 3 prime probably benign
R4513:Sbp UTSW 17 23945312 missense probably benign 0.04
R4774:Sbp UTSW 17 23945244 missense probably damaging 1.00
R5338:Sbp UTSW 17 23942422 start gained probably benign
R5576:Sbp UTSW 17 23945578 missense probably benign 0.05
R7315:Sbp UTSW 17 23945306 missense probably benign 0.10
R7894:Sbp UTSW 17 23942189 intron probably benign
RF003:Sbp UTSW 17 23945369 small insertion probably benign
RF010:Sbp UTSW 17 23945351 small insertion probably benign
RF011:Sbp UTSW 17 23945354 small insertion probably benign
RF024:Sbp UTSW 17 23945387 small insertion probably benign
RF037:Sbp UTSW 17 23945384 small insertion probably benign
RF037:Sbp UTSW 17 23945387 small insertion probably benign
RF038:Sbp UTSW 17 23945384 small insertion probably benign
RF042:Sbp UTSW 17 23945384 small insertion probably benign
RF044:Sbp UTSW 17 23945366 small insertion probably benign
RF048:Sbp UTSW 17 23945389 small insertion probably benign
RF054:Sbp UTSW 17 23945371 small insertion probably benign
RF059:Sbp UTSW 17 23945377 small insertion probably benign
RF061:Sbp UTSW 17 23945377 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGTGACACTGGAGGTTC -3'
(R):5'- AGGACCACTCAGGCTCACATAG -3'

Sequencing Primer
(F):5'- GTTCAGACAAGCATCTAGTGACTGTC -3'
(R):5'- TCAGGCTCACATAGATGCACATAG -3'
Posted On2019-12-04