Incidental Mutation 'RF057:Calhm1'
ID605320
Institutional Source Beutler Lab
Gene Symbol Calhm1
Ensembl Gene ENSMUSG00000079258
Gene Namecalcium homeostasis modulator 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF057 (G1)
Quality Score217.468
Status Not validated
Chromosome19
Chromosomal Location47141035-47144174 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GCTGTGGC to GCTGTGGCTGTGTCTGTGGC at 47141270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035822] [ENSMUST00000111813] [ENSMUST00000140512]
Predicted Effect probably benign
Transcript: ENSMUST00000035822
SMART Domains Protein: ENSMUSP00000047278
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 256 2.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111813
SMART Domains Protein: ENSMUSP00000107444
Gene: ENSMUSG00000079258

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 1 255 5.6e-94 PFAM
low complexity region 267 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium channel that plays a role in processing of amyloid-beta precursor protein. A polymorphism at this locus has been reported to be associated with susceptibility to late-onset Alzheimer's disease in some populations, but the pathogenicity of this polymorphism is unclear.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cortical neuron electrical properties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik GCACATGCACACACA GCACA 4: 136,462,306 probably null Het
Alpk3 AAGGCACCGAC A 7: 81,092,417 probably null Het
Ankhd1 CGGC CGGCGGTGGC 18: 36,560,929 probably benign Het
Crtam TTCTTGATCTGAA T 9: 40,984,354 probably null Het
Cul9 CCT CCTACT 17: 46,500,863 probably null Het
Dmkn GAAGTGGTGGAAGTGGTGG GAAGTGGTGGAAGTGGTGGAAGTGGTGTAAGTGGTGGAAGTGGTGG 7: 30,767,188 probably benign Het
Efhd2 CGCCG CGCCGAAGCCG 4: 141,874,769 probably benign Het
Eps8 CGCTC CGCTCGCTC 6: 137,517,064 probably benign Het
Fam71e1 GGAGGA GGAGGAAGGCTGGATCCTGGATACCTGGGTCTGAGTGAGGA 7: 44,500,532 probably null Het
Gm16519 AAGCAG AAGCAGCAG 17: 70,929,331 probably benign Het
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Lypd8 CCAACA CCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCAACAACA 11: 58,390,239 probably benign Het
Mapk6 CCCCA CCCCATCCCA 9: 75,388,258 probably null Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Morn4 GTCAGGCAGTGA GTCAGGCAGTGACTCAGGCAGTGA 19: 42,076,106 probably null Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGGTTTTGTTTT 4: 134,279,368 probably null Het
Prp2 CACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCA C 6: 132,600,530 probably null Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 84,956,166 probably benign Het
Tcof1 TTTCCCAGAGATCCCCTTGGC TTTCCCAGAGATCCCCTTGGCTGCTGAGATGGGCACCTTCCCAGAGATCCCCTTGGC 18: 60,833,564 probably benign Het
Tcof1 TTCCCAGAGATCCCCTTGGC TTCCCAGAGATCCCCTTGGCTGCTGAGATGGGCACTGTCCCAGAGATCCCCTTGGC 18: 60,833,565 probably benign Het
Tcof1 TCCCAGAGATCCCCTTGGC TCCCAGAGATCCCCTTGGCTGCTGAGATGGGCACTTGCCCAGAGATCCCCTTGGC 18: 60,833,566 probably benign Het
Tcof1 GAGATCCCCTTGGC GAGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCATAGATCCCCTTGGC 18: 60,833,571 probably benign Het
Tgoln1 CAGAAT CAGAATCACCTCCCGTGGGCTTGCGAGAAT 6: 72,616,069 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,295 probably benign Het
Ttn ACCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTC 2: 76,843,390 probably benign Het
Zfp384 C CCCAGGCCCAGGG 6: 125,036,496 probably benign Het
Other mutations in Calhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Calhm1 UTSW 19 47141251 unclassified probably benign
FR4449:Calhm1 UTSW 19 47141274 unclassified probably benign
FR4976:Calhm1 UTSW 19 47141262 unclassified probably benign
R0328:Calhm1 UTSW 19 47141303 missense possibly damaging 0.46
R0402:Calhm1 UTSW 19 47141457 missense probably damaging 0.98
R0463:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R0608:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R1552:Calhm1 UTSW 19 47141201 missense probably benign 0.00
R4647:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R4648:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R5762:Calhm1 UTSW 19 47143619 splice site probably null
R5766:Calhm1 UTSW 19 47143703 missense probably benign 0.00
RF001:Calhm1 UTSW 19 47141276 unclassified probably benign
RF010:Calhm1 UTSW 19 47141273 unclassified probably benign
RF014:Calhm1 UTSW 19 47141265 unclassified probably benign
RF015:Calhm1 UTSW 19 47141256 unclassified probably benign
RF023:Calhm1 UTSW 19 47141273 unclassified probably benign
RF025:Calhm1 UTSW 19 47141276 unclassified probably benign
RF025:Calhm1 UTSW 19 47141277 unclassified probably benign
RF030:Calhm1 UTSW 19 47141253 unclassified probably benign
RF032:Calhm1 UTSW 19 47141283 frame shift probably null
RF035:Calhm1 UTSW 19 47141253 unclassified probably benign
RF036:Calhm1 UTSW 19 47141277 unclassified probably benign
RF040:Calhm1 UTSW 19 47141277 unclassified probably benign
RF050:Calhm1 UTSW 19 47141270 unclassified probably benign
RF063:Calhm1 UTSW 19 47141256 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGTAGGTGGCCACTTCCTTG -3'
(R):5'- GCCTTTCTCAAGAGCAAGTACTGG -3'

Sequencing Primer
(F):5'- ACTTCCTTGCGTGGAGGC -3'
(R):5'- GGTCCCACTACATTGACATTGAG -3'
Posted On2019-12-04