Incidental Mutation 'RF058:Krtap28-10'
ID 605321
Institutional Source Beutler Lab
Gene Symbol Krtap28-10
Ensembl Gene ENSMUSG00000100190
Gene Name keratin associated protein 28-10
Synonyms 4733401N17Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.149) question?
Stock # RF058 (G1)
Quality Score 138.467
Status Not validated
Chromosome 1
Chromosomal Location 83019245-83020201 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) ACAGCCACCACAGCCACAGCCACCACAGC to ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC at 83019983 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473] [ENSMUST00000188323] [ENSMUST00000222567]
AlphaFold A0A1Y7VP58
Predicted Effect probably benign
Transcript: ENSMUST00000045560
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164473
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188323
Predicted Effect probably benign
Transcript: ENSMUST00000222567
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,637,826 (GRCm39) probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,529,850 (GRCm39) probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,864 (GRCm39) probably benign Het
Alg9 GGC GGCTGC 9: 50,686,727 (GRCm39) probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 5,045,858 (GRCm39) probably benign Het
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Het
Chga CAG CAGAAG 12: 102,527,675 (GRCm39) probably benign Het
Cort GCCCACTCGT G 4: 149,209,869 (GRCm39) probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,981,151 (GRCm39) probably null Het
Gab3 TCT TCTACT X: 74,043,608 (GRCm39) probably benign Het
Gabre C CCGGCTG X: 71,313,669 (GRCm39) probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,787,492 (GRCm39) probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,179,966 (GRCm39) probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,179,970 (GRCm39) probably benign Het
Kri1 TCCTCCTCC TC 9: 21,192,362 (GRCm39) probably null Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,406,680 (GRCm39) probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,891,021 (GRCm39) probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 85,682,801 (GRCm39) probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,384,490 (GRCm39) probably benign Het
Treml1 ACCT A 17: 48,666,975 (GRCm39) probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,851,244 (GRCm39) probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,899,735 (GRCm39) probably benign Het
Other mutations in Krtap28-10
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Krtap28-10 UTSW 1 83,019,844 (GRCm39) unclassified probably benign
R8865:Krtap28-10 UTSW 1 83,019,808 (GRCm39) missense unknown
R8984:Krtap28-10 UTSW 1 83,019,894 (GRCm39) missense unknown
RF001:Krtap28-10 UTSW 1 83,020,003 (GRCm39) unclassified probably benign
RF001:Krtap28-10 UTSW 1 83,019,976 (GRCm39) unclassified probably benign
RF001:Krtap28-10 UTSW 1 83,020,001 (GRCm39) unclassified probably benign
RF008:Krtap28-10 UTSW 1 83,019,974 (GRCm39) unclassified probably benign
RF008:Krtap28-10 UTSW 1 83,020,000 (GRCm39) unclassified probably benign
RF008:Krtap28-10 UTSW 1 83,019,849 (GRCm39) unclassified probably benign
RF008:Krtap28-10 UTSW 1 83,019,856 (GRCm39) unclassified probably benign
RF012:Krtap28-10 UTSW 1 83,019,857 (GRCm39) unclassified probably benign
RF013:Krtap28-10 UTSW 1 83,019,995 (GRCm39) unclassified probably benign
RF013:Krtap28-10 UTSW 1 83,019,856 (GRCm39) unclassified probably benign
RF014:Krtap28-10 UTSW 1 83,019,972 (GRCm39) unclassified probably benign
RF016:Krtap28-10 UTSW 1 83,019,844 (GRCm39) unclassified probably benign
RF017:Krtap28-10 UTSW 1 83,019,987 (GRCm39) unclassified probably benign
RF017:Krtap28-10 UTSW 1 83,019,859 (GRCm39) unclassified probably benign
RF018:Krtap28-10 UTSW 1 83,019,974 (GRCm39) unclassified probably benign
RF019:Krtap28-10 UTSW 1 83,019,990 (GRCm39) unclassified probably benign
RF023:Krtap28-10 UTSW 1 83,020,007 (GRCm39) unclassified probably benign
RF023:Krtap28-10 UTSW 1 83,019,867 (GRCm39) nonsense probably null
RF024:Krtap28-10 UTSW 1 83,019,973 (GRCm39) unclassified probably benign
RF024:Krtap28-10 UTSW 1 83,019,844 (GRCm39) unclassified probably benign
RF025:Krtap28-10 UTSW 1 83,019,979 (GRCm39) unclassified probably benign
RF026:Krtap28-10 UTSW 1 83,019,847 (GRCm39) unclassified probably benign
RF027:Krtap28-10 UTSW 1 83,020,006 (GRCm39) unclassified probably benign
RF028:Krtap28-10 UTSW 1 83,019,979 (GRCm39) unclassified probably benign
RF029:Krtap28-10 UTSW 1 83,019,991 (GRCm39) unclassified probably benign
RF032:Krtap28-10 UTSW 1 83,019,979 (GRCm39) unclassified probably benign
RF034:Krtap28-10 UTSW 1 83,020,003 (GRCm39) unclassified probably benign
RF035:Krtap28-10 UTSW 1 83,020,002 (GRCm39) unclassified probably benign
RF035:Krtap28-10 UTSW 1 83,019,867 (GRCm39) unclassified probably benign
RF037:Krtap28-10 UTSW 1 83,019,866 (GRCm39) unclassified probably benign
RF037:Krtap28-10 UTSW 1 83,020,007 (GRCm39) unclassified probably benign
RF038:Krtap28-10 UTSW 1 83,019,978 (GRCm39) unclassified probably benign
RF038:Krtap28-10 UTSW 1 83,019,849 (GRCm39) unclassified probably benign
RF042:Krtap28-10 UTSW 1 83,019,846 (GRCm39) unclassified probably benign
RF044:Krtap28-10 UTSW 1 83,019,852 (GRCm39) unclassified probably benign
RF045:Krtap28-10 UTSW 1 83,019,982 (GRCm39) unclassified probably benign
RF045:Krtap28-10 UTSW 1 83,019,864 (GRCm39) unclassified probably benign
RF049:Krtap28-10 UTSW 1 83,020,006 (GRCm39) unclassified probably benign
RF049:Krtap28-10 UTSW 1 83,019,859 (GRCm39) unclassified probably benign
RF053:Krtap28-10 UTSW 1 83,019,999 (GRCm39) unclassified probably benign
RF055:Krtap28-10 UTSW 1 83,019,991 (GRCm39) unclassified probably benign
RF055:Krtap28-10 UTSW 1 83,019,983 (GRCm39) unclassified probably benign
RF055:Krtap28-10 UTSW 1 83,019,851 (GRCm39) unclassified probably benign
RF059:Krtap28-10 UTSW 1 83,020,011 (GRCm39) unclassified probably benign
RF059:Krtap28-10 UTSW 1 83,019,996 (GRCm39) unclassified probably benign
RF061:Krtap28-10 UTSW 1 83,020,002 (GRCm39) unclassified probably benign
RF064:Krtap28-10 UTSW 1 83,019,852 (GRCm39) unclassified probably benign
Z1177:Krtap28-10 UTSW 1 83,019,880 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCGTAGCTTAGAACCAGAGCC -3'
(R):5'- TCCTCTCTACTGACAACATGGG -3'

Sequencing Primer
(F):5'- GCTAGCAGCAGCACTTCTTG -3'
(R):5'- AACATGGGTTGTTGTGGCTG -3'
Posted On 2019-12-04