Incidental Mutation 'RF058:Cort'
ID 605325
Institutional Source Beutler Lab
Gene Symbol Cort
Ensembl Gene ENSMUSG00000028971
Gene Name cortistatin
Synonyms PCST, CST
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF058 (G1)
Quality Score 214.458
Status Not validated
Chromosome 4
Chromosomal Location 149209491-149211220 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GCCCACTCGT to G at 149209869 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030813] [ENSMUST00000030815] [ENSMUST00000030816] [ENSMUST00000105696] [ENSMUST00000150150] [ENSMUST00000176124] [ENSMUST00000177408]
AlphaFold P56469
Predicted Effect probably benign
Transcript: ENSMUST00000030813
SMART Domains Protein: ENSMUSP00000030813
Gene: ENSMUSG00000073705

DomainStartEndE-ValueType
Pfam:CENP-S 16 91 1.4e-36 PFAM
Pfam:CENP-T_C 18 116 2.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030815
SMART Domains Protein: ENSMUSP00000030815
Gene: ENSMUSG00000028971

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 65 78 N/A INTRINSIC
Pfam:Somatostatin 91 108 9.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030816
SMART Domains Protein: ENSMUSP00000030816
Gene: ENSMUSG00000028974

DomainStartEndE-ValueType
CAD 19 94 1.79e-47 SMART
Pfam:DFF-C 100 264 1.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105696
SMART Domains Protein: ENSMUSP00000101321
Gene: ENSMUSG00000073705

DomainStartEndE-ValueType
Pfam:CENP-S 16 76 2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150150
SMART Domains Protein: ENSMUSP00000121878
Gene: ENSMUSG00000073705

DomainStartEndE-ValueType
Pfam:CENP-S 1 26 7.3e-14 PFAM
low complexity region 43 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176124
SMART Domains Protein: ENSMUSP00000134756
Gene: ENSMUSG00000073705

DomainStartEndE-ValueType
Pfam:CENP-S 1 26 1.4e-13 PFAM
low complexity region 43 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177408
SMART Domains Protein: ENSMUSP00000135536
Gene: ENSMUSG00000073705

DomainStartEndE-ValueType
Pfam:CENP-S 16 64 1.2e-12 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the somatostatin family of multifunctional peptides attributed with neurohormone, neurotransmitter/modulator and autocrine/paracrine actions. The encoded preproprotein undergoes proteolytic processing to generate a mature functional peptide that can bind to somatostatin receptors. Mice lacking the encoded protein exhibit elevated levels of growth hormone in the plasma without major changes in somatic growth and have exacerbated nociceptive responses to neuropathic and inflammatory pain sensitization. Transgenic mice overexpressing the encoded protein in neurons do not express long-term potentiation in the dentate gyrus and exhibit deficits in synaptic plasticity and learning. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating growth hormone and adrenocorticotropin, decreased serum prolactin, and insulin resistance and increased serum glucose level in male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,637,826 (GRCm39) probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,529,850 (GRCm39) probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,864 (GRCm39) probably benign Het
Alg9 GGC GGCTGC 9: 50,686,727 (GRCm39) probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 5,045,858 (GRCm39) probably benign Het
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Het
Chga CAG CAGAAG 12: 102,527,675 (GRCm39) probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,981,151 (GRCm39) probably null Het
Gab3 TCT TCTACT X: 74,043,608 (GRCm39) probably benign Het
Gabre C CCGGCTG X: 71,313,669 (GRCm39) probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,787,492 (GRCm39) probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,179,970 (GRCm39) probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,179,966 (GRCm39) probably benign Het
Kri1 TCCTCCTCC TC 9: 21,192,362 (GRCm39) probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,019,983 (GRCm39) probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,406,680 (GRCm39) probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,891,021 (GRCm39) probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 85,682,801 (GRCm39) probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,384,490 (GRCm39) probably benign Het
Treml1 ACCT A 17: 48,666,975 (GRCm39) probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,851,244 (GRCm39) probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,899,735 (GRCm39) probably benign Het
Other mutations in Cort
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Cort APN 4 149,209,752 (GRCm39) missense probably damaging 1.00
R6537:Cort UTSW 4 149,211,081 (GRCm39) missense probably benign
R7079:Cort UTSW 4 149,211,848 (GRCm39) missense probably benign 0.11
R7383:Cort UTSW 4 149,209,861 (GRCm39) missense possibly damaging 0.78
R7994:Cort UTSW 4 149,209,762 (GRCm39) missense probably damaging 1.00
RF022:Cort UTSW 4 149,209,869 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTCGTTGGCATCTCACAGG -3'
(R):5'- CACTCTGACTTTGAGGGAGTG -3'

Sequencing Primer
(F):5'- TTGGCATCTCACAGGGTGGC -3'
(R):5'- AAGGAACAGTTTGCTCTCTGTG -3'
Posted On 2019-12-04