Mutagenetix > Incidental Mutation

Incidental Mutation 'RF058:Chd4'

605326

Institutional Source

Beutler Lab

Gene Symbol

Chd4

Ensembl Gene

ENSMUSG00000063870

Gene Name

chromodomain helicase DNA binding protein 4

Synonyms

D6Ertd380e, Mi-2beta, 9530019N15Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

RF058 (G1)

Quality Score

214.458

Status

Not validated

Chromosome

Chromosomal Location

125095981-125130591 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

GC to GCTCCCTC at 125122131 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120704 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392] [ENSMUST00000124317]

AlphaFold

Q6PDQ2

Predicted Effect

probably benign
Transcript: ENSMUST00000056889

SMART Domains

Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
low complexity region	107	144	N/A	INTRINSIC
Pfam:CHDNT	156	210	7.7e-35	PFAM
low complexity region	217	249	N/A	INTRINSIC
low complexity region	271	291	N/A	INTRINSIC
low complexity region	296	318	N/A	INTRINSIC
low complexity region	321	347	N/A	INTRINSIC
PHD	365	408	7.17e-15	SMART
RING	366	407	7.46e-1	SMART
low complexity region	424	443	N/A	INTRINSIC
PHD	444	487	4.41e-15	SMART
RING	445	486	2.63e0	SMART
CHROMO	492	572	8.11e-17	SMART
CHROMO	613	670	1.98e-11	SMART
low complexity region	675	694	N/A	INTRINSIC
DEXDc	715	927	2.73e-37	SMART
low complexity region	1044	1056	N/A	INTRINSIC
HELICc	1073	1157	7.61e-27	SMART
DUF1087	1282	1346	5.56e-33	SMART
DUF1086	1359	1516	4.05e-108	SMART
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1590	1633	N/A	INTRINSIC
low complexity region	1635	1653	N/A	INTRINSIC
low complexity region	1661	1674	N/A	INTRINSIC
Pfam:CHDCT2	1727	1899	1.9e-98	PFAM
low complexity region	1903	1915	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112390

SMART Domains

Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	87	99	N/A	INTRINSIC
low complexity region	114	151	N/A	INTRINSIC
Pfam:CHDNT	164	217	2e-28	PFAM
low complexity region	224	256	N/A	INTRINSIC
low complexity region	278	298	N/A	INTRINSIC
low complexity region	303	325	N/A	INTRINSIC
low complexity region	328	354	N/A	INTRINSIC
PHD	372	415	7.17e-15	SMART
RING	373	414	7.46e-1	SMART
low complexity region	431	450	N/A	INTRINSIC
PHD	451	494	4.41e-15	SMART
RING	452	493	2.63e0	SMART
CHROMO	499	579	8.11e-17	SMART
CHROMO	620	677	1.98e-11	SMART
low complexity region	682	701	N/A	INTRINSIC
DEXDc	722	934	2.73e-37	SMART
low complexity region	1051	1063	N/A	INTRINSIC
HELICc	1080	1164	7.61e-27	SMART
DUF1087	1289	1353	5.56e-33	SMART
DUF1086	1366	1523	4.05e-108	SMART
low complexity region	1533	1547	N/A	INTRINSIC
low complexity region	1567	1585	N/A	INTRINSIC
low complexity region	1597	1640	N/A	INTRINSIC
low complexity region	1642	1660	N/A	INTRINSIC
low complexity region	1668	1681	N/A	INTRINSIC
Pfam:CHDCT2	1735	1906	4.3e-90	PFAM
low complexity region	1910	1922	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112392

SMART Domains

Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
low complexity region	107	144	N/A	INTRINSIC
Pfam:CHDNT	156	210	1.1e-34	PFAM
low complexity region	217	249	N/A	INTRINSIC
low complexity region	271	291	N/A	INTRINSIC
low complexity region	296	318	N/A	INTRINSIC
low complexity region	321	347	N/A	INTRINSIC
PHD	352	395	7.17e-15	SMART
RING	353	394	7.46e-1	SMART
low complexity region	411	430	N/A	INTRINSIC
PHD	431	474	4.41e-15	SMART
RING	432	473	2.63e0	SMART
CHROMO	479	559	8.11e-17	SMART
CHROMO	600	657	1.98e-11	SMART
low complexity region	662	681	N/A	INTRINSIC
DEXDc	702	914	2.73e-37	SMART
low complexity region	1031	1043	N/A	INTRINSIC
HELICc	1060	1144	7.61e-27	SMART
DUF1087	1269	1333	5.56e-33	SMART
DUF1086	1346	1503	4.05e-108	SMART
low complexity region	1513	1527	N/A	INTRINSIC
low complexity region	1547	1565	N/A	INTRINSIC
low complexity region	1577	1620	N/A	INTRINSIC
low complexity region	1622	1640	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC
Pfam:CHDCT2	1714	1886	2.8e-98	PFAM
low complexity region	1890	1902	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124317

SMART Domains

Protein: ENSMUSP00000120704
Gene: ENSMUSG00000063870

Domain	Start	End	E-Value	Type
PDB:3MWY\|W	1	137	2e-13	PDB
DUF1087	141	205	5.56e-33	SMART
low complexity region	209	221	N/A	INTRINSIC
DUF1086	246	403	4.05e-108	SMART
low complexity region	413	427	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132794

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157583

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.3%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the SNF2/RAD54 helicase family. It represents the main component of the nucleosome remodeling and deacetylase complex and plays an important role in epigenetic transcriptional repression. Patients with dermatomyositis develop antibodies against this protein. Somatic mutations in this gene are associated with serous endometrial tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality between E3.5 and E4.5, absent blastocoele failure of trophectoderm function and increased apoptosis in blastocysts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Predicted Effect	Zygosity
3110021N24Rik	GAGCGCGGCC	G	4: 108,780,629	probably benign	Het
5430401F13Rik	CAG	CAGCAAAAACAGAAAGGAAAAGGTGGCCAG	6: 131,552,901	probably benign	Het
5430401F13Rik	AAGGAAAAGGTGGCCAG	AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG	6: 131,552,887	probably benign	Het
Alg9	GGC	GGCTGC	9: 50,775,427	probably benign	Het
Arid1b	CGGGGG	CGGGGGGGG	17: 4,995,583	probably benign	Het
Chga	CAG	CAGAAG	12: 102,561,416	probably benign	Het
Cort	GCCCACTCGT	G	4: 149,125,412	probably benign	Het
Flywch1	GT	GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT	17: 23,762,177	probably null	Het
Gab3	TCT	TCTACT	X: 75,000,002	probably benign	Het
Gabre	C	CCGGCTG	X: 72,270,063	probably benign	Het
Haus4	CACTTAAAAAAAAAA	CA	14: 54,550,035	probably benign	Het
Il2	AG	AGGGCTTGAAGTGG	3: 37,125,817	probably benign	Het
Il2	CTTGAAGTGG	CTTGAAGTGGGGATTGAAGTGG	3: 37,125,821	probably benign	Het
Kri1	TCCTCCTCC	TC	9: 21,281,066	probably null	Het
Krtap28-10	ACAGCCACCACAGCCACAGCCACCACAGC	ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC	1: 83,042,262	probably benign	Het
Mbd1	CGTCTTCGTCTGCATCTGCATCTGCA	C	18: 74,273,609	probably null	Het
Nefh	CCTC	CCTCGCCTGGGGACTTGGACTC	11: 4,941,021	probably benign	Het
Rtbdn	GCAGCG	GCAGCGACAGCG	8: 84,956,172	probably benign	Het
Setd1a	GTGGTGGT	GTGGTGGTATTGGTGGT	7: 127,785,318	probably benign	Het
Treml1	ACCT	A	17: 48,359,947	probably null	Het
Triobp	CTCCCTGTGCCCAAC	CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC	15: 78,967,044	probably benign	Het
Zfp598	CCCACCACCACAACCACCACCACCACCACCAC	CCCACCACCACCACCACAACCACCACCACCACCACCAC	17: 24,680,761	probably benign	Het

Other mutations in Chd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Chd4	APN	6	125109897	missense	probably damaging	1.00
IGL00917:Chd4	APN	6	125104946	missense	possibly damaging	0.95
IGL01088:Chd4	APN	6	125122468	unclassified	probably benign
IGL02005:Chd4	APN	6	125128816	missense	possibly damaging	0.71
IGL02405:Chd4	APN	6	125097227	missense	probably benign	0.06
IGL02707:Chd4	APN	6	125108767	missense	probably damaging	1.00
IGL02976:Chd4	APN	6	125121368	missense	probably damaging	1.00
IGL03001:Chd4	APN	6	125101566	missense	possibly damaging	0.93
FR4304:Chd4	UTSW	6	125122144	unclassified	probably benign
FR4589:Chd4	UTSW	6	125122133	missense	probably benign	0.02
FR4589:Chd4	UTSW	6	125122139	unclassified	probably benign
FR4737:Chd4	UTSW	6	125122131	unclassified	probably benign
FR4976:Chd4	UTSW	6	125122131	unclassified	probably benign
R0311:Chd4	UTSW	6	125101665	missense	probably benign	0.15
R0414:Chd4	UTSW	6	125107480	missense	probably damaging	1.00
R0647:Chd4	UTSW	6	125109123	missense	probably damaging	1.00
R0656:Chd4	UTSW	6	125102967	missense	probably damaging	0.98
R1342:Chd4	UTSW	6	125097188	missense	probably benign	0.40
R1651:Chd4	UTSW	6	125123584	missense	possibly damaging	0.92
R1850:Chd4	UTSW	6	125121656	missense	probably damaging	1.00
R2190:Chd4	UTSW	6	125114297	missense	probably benign	0.18
R2192:Chd4	UTSW	6	125105357	missense	probably damaging	0.99
R2858:Chd4	UTSW	6	125104886	missense	probably damaging	0.99
R3406:Chd4	UTSW	6	125122007	missense	probably benign	0.09
R3431:Chd4	UTSW	6	125120560	splice site	probably benign
R4330:Chd4	UTSW	6	125101602	missense	probably benign	0.29
R4394:Chd4	UTSW	6	125121618	missense	probably damaging	0.99
R4538:Chd4	UTSW	6	125120686	missense	probably damaging	0.99
R4664:Chd4	UTSW	6	125101502	missense	possibly damaging	0.58
R4805:Chd4	UTSW	6	125128945	missense	possibly damaging	0.86
R5050:Chd4	UTSW	6	125107480	missense	probably damaging	1.00
R5055:Chd4	UTSW	6	125100986	missense	possibly damaging	0.65
R5232:Chd4	UTSW	6	125121310	missense	probably damaging	1.00
R5314:Chd4	UTSW	6	125100588	missense	probably damaging	0.96
R5343:Chd4	UTSW	6	125120363	missense	probably damaging	1.00
R5502:Chd4	UTSW	6	125105276	missense	possibly damaging	0.83
R5613:Chd4	UTSW	6	125120546	missense	probably damaging	0.99
R6211:Chd4	UTSW	6	125101285	missense	possibly damaging	0.82
R6606:Chd4	UTSW	6	125109426	missense	probably damaging	0.99
R6753:Chd4	UTSW	6	125114300	missense	probably benign	0.01
R6808:Chd4	UTSW	6	125122123	missense	possibly damaging	0.53
R6939:Chd4	UTSW	6	125106538	missense	probably damaging	0.99
R6968:Chd4	UTSW	6	125108318	missense	probably damaging	1.00
R6973:Chd4	UTSW	6	125122862	missense	possibly damaging	0.53
R6992:Chd4	UTSW	6	125114376	missense	probably benign	0.14
R7058:Chd4	UTSW	6	125108442	missense	possibly damaging	0.74
R7081:Chd4	UTSW	6	125129985	missense	unknown
R7253:Chd4	UTSW	6	125106592	splice site	probably null
R7423:Chd4	UTSW	6	125128859	missense	possibly damaging	0.92
R7535:Chd4	UTSW	6	125128873	missense	probably benign	0.32
R7566:Chd4	UTSW	6	125101903	missense	possibly damaging	0.86
R8053:Chd4	UTSW	6	125128816	nonsense	probably null
R8155:Chd4	UTSW	6	125105324	missense	probably benign	0.00
R8711:Chd4	UTSW	6	125123522	unclassified	probably benign
R8783:Chd4	UTSW	6	125123384	missense	possibly damaging	0.53
R9020:Chd4	UTSW	6	125107506	missense	probably damaging	1.00
R9093:Chd4	UTSW	6	125114011	missense	probably benign	0.13
R9417:Chd4	UTSW	6	125120725	missense	probably damaging	0.99
R9509:Chd4	UTSW	6	125122522	missense	possibly damaging	0.96
RF046:Chd4	UTSW	6	125122131	unclassified	probably benign
RF052:Chd4	UTSW	6	125122145	unclassified	probably benign
RF060:Chd4	UTSW	6	125122145	unclassified	probably benign
X0025:Chd4	UTSW	6	125106467	nonsense	probably null
X0027:Chd4	UTSW	6	125102164	missense	probably damaging	0.98
X0063:Chd4	UTSW	6	125114015	missense	probably damaging	1.00
Z1176:Chd4	UTSW	6	125100860	missense	possibly damaging	0.93
Z1176:Chd4	UTSW	6	125101598	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- GAACAGAGCATGACATGGCCTC -3'
(R):5'- TACAGAGCGGCCTTCAGTTG -3'

Sequencing Primer
(F):5'- ATGACATGGCCTCTGACCCAG -3'
(R):5'- GCGGCCTTCAGTTGCTCATATTTAC -3'

Posted On

2019-12-04