Incidental Mutation 'RF058:Rtbdn'
ID605330
Institutional Source Beutler Lab
Gene Symbol Rtbdn
Ensembl Gene ENSMUSG00000048617
Gene Nameretbindin
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF058 (G1)
Quality Score217.47
Status Not validated
Chromosome8
Chromosomal Location84946991-84956603 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCAGCG to GCAGCGACAGCG at 84956172 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065049] [ENSMUST00000067472] [ENSMUST00000109736] [ENSMUST00000109738] [ENSMUST00000109740] [ENSMUST00000121880] [ENSMUST00000128972] [ENSMUST00000147812] [ENSMUST00000152378]
Predicted Effect probably benign
Transcript: ENSMUST00000065049
SMART Domains Protein: ENSMUSP00000066769
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 7.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067472
SMART Domains Protein: ENSMUSP00000070558
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 2e-40 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109736
SMART Domains Protein: ENSMUSP00000105358
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109738
SMART Domains Protein: ENSMUSP00000105360
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 5.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109740
SMART Domains Protein: ENSMUSP00000105362
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 3.5e-42 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121880
SMART Domains Protein: ENSMUSP00000113982
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 3.5e-42 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128972
SMART Domains Protein: ENSMUSP00000121864
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:RNase_HII 57 268 1.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147812
SMART Domains Protein: ENSMUSP00000120374
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152378
SMART Domains Protein: ENSMUSP00000132841
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 2 172 2.8e-38 PFAM
low complexity region 193 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first identified in a study of human eye tissues. The protein encoded by this gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,780,629 probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,552,887 probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,901 probably benign Het
Alg9 GGC GGCTGC 9: 50,775,427 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Chd4 GC GCTCCCTC 6: 125,122,131 probably benign Het
Chga CAG CAGAAG 12: 102,561,416 probably benign Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,762,177 probably null Het
Gab3 TCT TCTACT X: 75,000,002 probably benign Het
Gabre C CCGGCTG X: 72,270,063 probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,550,035 probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,125,817 probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,125,821 probably benign Het
Kri1 TCCTCCTCC TC 9: 21,281,066 probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,262 probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,273,609 probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,941,021 probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,785,318 probably benign Het
Treml1 ACCT A 17: 48,359,947 probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,967,044 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Other mutations in Rtbdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02892:Rtbdn APN 8 84955089 missense probably damaging 1.00
IGL03192:Rtbdn APN 8 84952655 missense probably benign 0.32
FR4342:Rtbdn UTSW 8 84956168 small insertion probably benign
FR4342:Rtbdn UTSW 8 84956178 small insertion probably benign
FR4589:Rtbdn UTSW 8 84956171 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956161 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956168 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956176 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956177 small insertion probably benign
R1581:Rtbdn UTSW 8 84955066 missense probably benign 0.01
R5057:Rtbdn UTSW 8 84955009 missense probably damaging 1.00
R6788:Rtbdn UTSW 8 84952674 missense probably null 1.00
R7570:Rtbdn UTSW 8 84952927 missense probably damaging 1.00
RF023:Rtbdn UTSW 8 84956166 small insertion probably benign
RF024:Rtbdn UTSW 8 84956179 small insertion probably benign
RF025:Rtbdn UTSW 8 84956175 small insertion probably benign
RF034:Rtbdn UTSW 8 84956175 small insertion probably benign
RF046:Rtbdn UTSW 8 84956179 small insertion probably benign
RF050:Rtbdn UTSW 8 84956170 small insertion probably benign
RF056:Rtbdn UTSW 8 84956170 small insertion probably benign
RF056:Rtbdn UTSW 8 84956172 small insertion probably benign
RF057:Rtbdn UTSW 8 84956166 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGCCATACCTAGTCCAGAAGAC -3'
(R):5'- GTGTTTTCCCAAGCAGCAGC -3'

Sequencing Primer
(F):5'- AGCCCAGAGACTCAGGTTC -3'
(R):5'- CAAGCAGCAGCCATGTCGTATG -3'
Posted On2019-12-04