Incidental Mutation 'RF058:Kri1'
ID605331
Institutional Source Beutler Lab
Gene Symbol Kri1
Ensembl Gene ENSMUSG00000035047
Gene NameKRI1 homolog
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF058 (G1)
Quality Score217.468
Status Not validated
Chromosome9
Chromosomal Location21273457-21287969 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCCTCCTCC to TC at 21281066 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038671] [ENSMUST00000065005] [ENSMUST00000184326]
Predicted Effect probably null
Transcript: ENSMUST00000038671
SMART Domains Protein: ENSMUSP00000039688
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
Pfam:Kri1 346 439 3.2e-27 PFAM
Pfam:Kri1_C 507 595 8.4e-37 PFAM
low complexity region 653 666 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065005
SMART Domains Protein: ENSMUSP00000068450
Gene: ENSMUSG00000002820

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
Pfam:Peptidase_C54 109 411 5.7e-107 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000184326
SMART Domains Protein: ENSMUSP00000139184
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
Pfam:Kri1 207 317 4.4e-27 PFAM
Pfam:Kri1_C 381 472 3.6e-36 PFAM
low complexity region 529 542 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene overlaps with the gene for cysteine endopeptidase AUT-like 4 in a head-to-tail orientation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,780,629 probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,552,887 probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,901 probably benign Het
Alg9 GGC GGCTGC 9: 50,775,427 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Chd4 GC GCTCCCTC 6: 125,122,131 probably benign Het
Chga CAG CAGAAG 12: 102,561,416 probably benign Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,762,177 probably null Het
Gab3 TCT TCTACT X: 75,000,002 probably benign Het
Gabre C CCGGCTG X: 72,270,063 probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,550,035 probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,125,817 probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,125,821 probably benign Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,262 probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,273,609 probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,941,021 probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 84,956,172 probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,785,318 probably benign Het
Treml1 ACCT A 17: 48,359,947 probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,967,044 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Other mutations in Kri1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Kri1 APN 9 21280427 missense probably damaging 1.00
IGL02272:Kri1 APN 9 21276168 missense probably damaging 1.00
IGL03229:Kri1 APN 9 21282070 missense probably damaging 1.00
FR4548:Kri1 UTSW 9 21281050 small deletion probably benign
R0040:Kri1 UTSW 9 21281105 missense probably damaging 1.00
R0054:Kri1 UTSW 9 21275365 missense probably damaging 1.00
R0054:Kri1 UTSW 9 21275365 missense probably damaging 1.00
R0284:Kri1 UTSW 9 21276552 splice site probably benign
R0665:Kri1 UTSW 9 21281640 intron probably benign
R1632:Kri1 UTSW 9 21282211 missense possibly damaging 0.89
R1640:Kri1 UTSW 9 21280457 missense possibly damaging 0.61
R1847:Kri1 UTSW 9 21280492 splice site probably benign
R3154:Kri1 UTSW 9 21281894 missense possibly damaging 0.51
R4222:Kri1 UTSW 9 21281063 missense probably benign 0.00
R4572:Kri1 UTSW 9 21280384 missense probably damaging 1.00
R4905:Kri1 UTSW 9 21287702 missense probably benign 0.19
R5236:Kri1 UTSW 9 21275941 missense probably damaging 1.00
R5539:Kri1 UTSW 9 21279372 nonsense probably null
R5696:Kri1 UTSW 9 21280237 missense probably damaging 1.00
R5701:Kri1 UTSW 9 21281129 missense possibly damaging 0.89
R6031:Kri1 UTSW 9 21275269 missense probably benign 0.03
R6031:Kri1 UTSW 9 21275269 missense probably benign 0.03
R6991:Kri1 UTSW 9 21287754 unclassified probably benign
R6994:Kri1 UTSW 9 21287787 unclassified probably benign
R7095:Kri1 UTSW 9 21279432 missense
R7339:Kri1 UTSW 9 21286587 missense
R7652:Kri1 UTSW 9 21281056 small deletion probably benign
R7787:Kri1 UTSW 9 21281084 missense
R7908:Kri1 UTSW 9 21281056 small deletion probably benign
RF027:Kri1 UTSW 9 21281068 frame shift probably null
RF028:Kri1 UTSW 9 21281071 frame shift probably null
Z1088:Kri1 UTSW 9 21274122 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACCCTGCAAAGAGGTGAATG -3'
(R):5'- CATCCCAGGCTATCTCTGTG -3'

Sequencing Primer
(F):5'- TTTGAACATCGGACCTTCGGAAG -3'
(R):5'- TCTGTGCCCCTCACCAGG -3'
Posted On2019-12-04