Incidental Mutation 'RF058:Alg9'
ID 605332
Institutional Source Beutler Lab
Gene Symbol Alg9
Ensembl Gene ENSMUSG00000032059
Gene Name ALG9 alpha-1,2-mannosyltransferase
Synonyms B430313H07Rik, 8230402H15Rik, Dibd1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF058 (G1)
Quality Score 179.472
Status Not validated
Chromosome 9
Chromosomal Location 50686570-50754939 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GGC to GGCTGC at 50686727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034561] [ENSMUST00000042391] [ENSMUST00000159576] [ENSMUST00000162073] [ENSMUST00000176145] [ENSMUST00000176335] [ENSMUST00000177384]
AlphaFold Q8VDI9
Predicted Effect probably benign
Transcript: ENSMUST00000034561
SMART Domains Protein: ENSMUSP00000034561
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 482 3.5e-127 PFAM
low complexity region 598 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042391
SMART Domains Protein: ENSMUSP00000037082
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
Pfam:DUF2431 7 176 1.4e-44 PFAM
low complexity region 258 269 N/A INTRINSIC
SCOP:d1jjca_ 487 516 6e-4 SMART
FDX-ACB 528 622 5.88e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159576
SMART Domains Protein: ENSMUSP00000123711
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 228 1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162073
SMART Domains Protein: ENSMUSP00000125425
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 167 7.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176145
SMART Domains Protein: ENSMUSP00000135796
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
Pfam:DUF2431 7 115 4.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176335
SMART Domains Protein: ENSMUSP00000135658
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1jjca_ 285 314 3e-4 SMART
FDX-ACB 326 420 5.88e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177384
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1,2-mannosyltransferase enzyme that functions in lipid-linked oligosaccharide assembly. Mutations in this gene result in congenital disorder of glycosylation type Il. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,637,826 (GRCm39) probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,529,850 (GRCm39) probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,864 (GRCm39) probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 5,045,858 (GRCm39) probably benign Het
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Het
Chga CAG CAGAAG 12: 102,527,675 (GRCm39) probably benign Het
Cort GCCCACTCGT G 4: 149,209,869 (GRCm39) probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,981,151 (GRCm39) probably null Het
Gab3 TCT TCTACT X: 74,043,608 (GRCm39) probably benign Het
Gabre C CCGGCTG X: 71,313,669 (GRCm39) probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,787,492 (GRCm39) probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,179,970 (GRCm39) probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,179,966 (GRCm39) probably benign Het
Kri1 TCCTCCTCC TC 9: 21,192,362 (GRCm39) probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,019,983 (GRCm39) probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,406,680 (GRCm39) probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,891,021 (GRCm39) probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 85,682,801 (GRCm39) probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,384,490 (GRCm39) probably benign Het
Treml1 ACCT A 17: 48,666,975 (GRCm39) probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,851,244 (GRCm39) probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,899,735 (GRCm39) probably benign Het
Other mutations in Alg9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Alg9 APN 9 50,686,677 (GRCm39) splice site probably null
IGL02792:Alg9 APN 9 50,754,048 (GRCm39) missense possibly damaging 0.90
gum_drop UTSW 9 50,716,654 (GRCm39) missense possibly damaging 0.90
FR4976:Alg9 UTSW 9 50,686,731 (GRCm39) unclassified probably benign
R1183:Alg9 UTSW 9 50,700,833 (GRCm39) missense possibly damaging 0.82
R1270:Alg9 UTSW 9 50,698,872 (GRCm39) intron probably benign
R1575:Alg9 UTSW 9 50,686,802 (GRCm39) missense possibly damaging 0.65
R1773:Alg9 UTSW 9 50,690,396 (GRCm39) missense probably benign 0.30
R1837:Alg9 UTSW 9 50,717,615 (GRCm39) missense probably damaging 1.00
R2011:Alg9 UTSW 9 50,699,500 (GRCm39) missense probably damaging 1.00
R4324:Alg9 UTSW 9 50,716,643 (GRCm39) missense probably damaging 1.00
R4514:Alg9 UTSW 9 50,716,654 (GRCm39) missense possibly damaging 0.90
R4544:Alg9 UTSW 9 50,716,654 (GRCm39) missense possibly damaging 0.90
R4546:Alg9 UTSW 9 50,716,654 (GRCm39) missense possibly damaging 0.90
R4996:Alg9 UTSW 9 50,720,005 (GRCm39) missense probably damaging 1.00
R5007:Alg9 UTSW 9 50,699,524 (GRCm39) missense probably damaging 1.00
R5053:Alg9 UTSW 9 50,699,472 (GRCm39) missense probably damaging 1.00
R5308:Alg9 UTSW 9 50,734,011 (GRCm39) missense possibly damaging 0.95
R6803:Alg9 UTSW 9 50,700,860 (GRCm39) missense probably benign 0.37
R6994:Alg9 UTSW 9 50,703,422 (GRCm39) nonsense probably null
R6998:Alg9 UTSW 9 50,700,921 (GRCm39) missense possibly damaging 0.95
R7298:Alg9 UTSW 9 50,690,361 (GRCm39) missense probably damaging 0.97
R7480:Alg9 UTSW 9 50,733,928 (GRCm39) missense probably benign 0.06
R7561:Alg9 UTSW 9 50,754,074 (GRCm39) missense possibly damaging 0.95
R7578:Alg9 UTSW 9 50,700,835 (GRCm39) missense probably benign
R7721:Alg9 UTSW 9 50,687,942 (GRCm39) missense probably damaging 0.99
R7829:Alg9 UTSW 9 50,699,471 (GRCm39) missense probably damaging 1.00
R7847:Alg9 UTSW 9 50,700,905 (GRCm39) missense possibly damaging 0.62
R7878:Alg9 UTSW 9 50,754,083 (GRCm39) missense probably benign 0.00
R8113:Alg9 UTSW 9 50,720,080 (GRCm39) nonsense probably null
R8257:Alg9 UTSW 9 50,690,387 (GRCm39) missense possibly damaging 0.62
R9214:Alg9 UTSW 9 50,717,545 (GRCm39) missense probably damaging 1.00
R9497:Alg9 UTSW 9 50,711,436 (GRCm39) missense probably damaging 0.97
R9511:Alg9 UTSW 9 50,717,525 (GRCm39) missense probably damaging 1.00
RF003:Alg9 UTSW 9 50,686,727 (GRCm39) unclassified probably benign
RF006:Alg9 UTSW 9 50,686,717 (GRCm39) unclassified probably benign
Z1177:Alg9 UTSW 9 50,699,473 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCATTGGCACAGTATTTCAG -3'
(R):5'- AGACCCTGGCTGCAAAGATG -3'

Sequencing Primer
(F):5'- GCACAGTATTTCAGTTTTTATTGCGC -3'
(R):5'- CGATGATCGACGCCAAGTG -3'
Posted On 2019-12-04