Incidental Mutation 'RF058:Chga'
ID 605334
Institutional Source Beutler Lab
Gene Symbol Chga
Ensembl Gene ENSMUSG00000021194
Gene Name chromogranin A
Synonyms ChrA
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # RF058 (G1)
Quality Score 210.468
Status Not validated
Chromosome 12
Chromosomal Location 102521228-102531287 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) CAG to CAGAAG at 102527675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021610]
AlphaFold P26339
Predicted Effect probably benign
Transcript: ENSMUST00000021610
SMART Domains Protein: ENSMUSP00000021610
Gene: ENSMUSG00000021194

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Granin 25 95 3e-26 PFAM
Pfam:Granin 87 463 1.7e-95 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the granin family of acidic secretory glycoproteins that are expressed in endocrine cells and neurons. The encoded preproprotein undergoes proteolytic processing to generate multiple functions peptides including pancreastatin, catestatin and serpinin. The encoded protein plays important roles in the neuroendocrine system including regulated secretion of peptide hormones and neurotransmitters. Mice lacking the encoded protein exhibit elevated blood pressure which can be rescued by transgenic expression of the human ortholog. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes and heterozygotes for one allele display hypertension, abnormal plasma and adrenal adrenaline and noradrenaline levels and, in homozygotes, partial embryonic lethality. Homozygotes for a second allele only have elevated urinary adrenaline, noradrenaline and dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,637,826 (GRCm39) probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,529,850 (GRCm39) probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,864 (GRCm39) probably benign Het
Alg9 GGC GGCTGC 9: 50,686,727 (GRCm39) probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 5,045,858 (GRCm39) probably benign Het
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Het
Cort GCCCACTCGT G 4: 149,209,869 (GRCm39) probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,981,151 (GRCm39) probably null Het
Gab3 TCT TCTACT X: 74,043,608 (GRCm39) probably benign Het
Gabre C CCGGCTG X: 71,313,669 (GRCm39) probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,787,492 (GRCm39) probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,179,970 (GRCm39) probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,179,966 (GRCm39) probably benign Het
Kri1 TCCTCCTCC TC 9: 21,192,362 (GRCm39) probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,019,983 (GRCm39) probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,406,680 (GRCm39) probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,891,021 (GRCm39) probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 85,682,801 (GRCm39) probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,384,490 (GRCm39) probably benign Het
Treml1 ACCT A 17: 48,666,975 (GRCm39) probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,851,244 (GRCm39) probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,899,735 (GRCm39) probably benign Het
Other mutations in Chga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chga APN 12 102,529,058 (GRCm39) missense probably damaging 0.98
IGL02674:Chga APN 12 102,529,160 (GRCm39) missense probably damaging 1.00
FR4589:Chga UTSW 12 102,527,661 (GRCm39) small insertion probably benign
R0018:Chga UTSW 12 102,524,764 (GRCm39) missense probably damaging 0.97
R0463:Chga UTSW 12 102,529,210 (GRCm39) nonsense probably null
R1164:Chga UTSW 12 102,529,304 (GRCm39) missense probably damaging 1.00
R1603:Chga UTSW 12 102,530,866 (GRCm39) splice site probably null
R1727:Chga UTSW 12 102,527,696 (GRCm39) missense possibly damaging 0.85
R1778:Chga UTSW 12 102,527,959 (GRCm39) missense probably benign
R1800:Chga UTSW 12 102,522,164 (GRCm39) missense probably damaging 0.99
R2071:Chga UTSW 12 102,529,122 (GRCm39) missense probably damaging 1.00
R3415:Chga UTSW 12 102,529,043 (GRCm39) missense probably benign 0.00
R3696:Chga UTSW 12 102,527,724 (GRCm39) missense probably damaging 0.98
R5022:Chga UTSW 12 102,529,096 (GRCm39) missense probably damaging 1.00
R5507:Chga UTSW 12 102,528,868 (GRCm39) missense probably benign 0.39
R5959:Chga UTSW 12 102,528,114 (GRCm39) missense probably benign
R7338:Chga UTSW 12 102,529,100 (GRCm39) missense probably damaging 1.00
R7410:Chga UTSW 12 102,528,866 (GRCm39) missense probably benign 0.00
R7694:Chga UTSW 12 102,527,606 (GRCm39) missense probably benign 0.05
R8084:Chga UTSW 12 102,528,328 (GRCm39) missense probably benign 0.29
R8211:Chga UTSW 12 102,527,678 (GRCm39) missense possibly damaging 0.71
R8505:Chga UTSW 12 102,528,004 (GRCm39) missense probably damaging 0.98
R8878:Chga UTSW 12 102,527,720 (GRCm39) missense possibly damaging 0.84
R9043:Chga UTSW 12 102,529,054 (GRCm39) missense possibly damaging 0.78
R9139:Chga UTSW 12 102,528,144 (GRCm39) missense probably benign 0.45
R9346:Chga UTSW 12 102,525,548 (GRCm39) missense probably damaging 0.99
R9764:Chga UTSW 12 102,525,613 (GRCm39) missense possibly damaging 0.71
RF001:Chga UTSW 12 102,527,682 (GRCm39) small insertion probably benign
RF002:Chga UTSW 12 102,527,680 (GRCm39) small insertion probably benign
RF006:Chga UTSW 12 102,527,671 (GRCm39) small insertion probably benign
RF009:Chga UTSW 12 102,527,679 (GRCm39) small insertion probably benign
RF010:Chga UTSW 12 102,527,662 (GRCm39) small insertion probably benign
RF014:Chga UTSW 12 102,527,664 (GRCm39) small insertion probably benign
RF014:Chga UTSW 12 102,527,652 (GRCm39) small insertion probably benign
RF015:Chga UTSW 12 102,527,679 (GRCm39) small insertion probably benign
RF022:Chga UTSW 12 102,527,679 (GRCm39) small insertion probably benign
RF033:Chga UTSW 12 102,527,655 (GRCm39) small insertion probably benign
RF035:Chga UTSW 12 102,527,686 (GRCm39) small insertion probably benign
RF044:Chga UTSW 12 102,527,655 (GRCm39) small insertion probably benign
RF048:Chga UTSW 12 102,527,680 (GRCm39) small insertion probably benign
RF048:Chga UTSW 12 102,527,662 (GRCm39) small insertion probably benign
RF049:Chga UTSW 12 102,527,652 (GRCm39) small insertion probably benign
RF052:Chga UTSW 12 102,527,675 (GRCm39) small insertion probably benign
RF054:Chga UTSW 12 102,527,682 (GRCm39) small insertion probably benign
RF056:Chga UTSW 12 102,527,683 (GRCm39) small insertion probably benign
RF060:Chga UTSW 12 102,527,683 (GRCm39) small insertion probably benign
RF061:Chga UTSW 12 102,527,686 (GRCm39) small insertion probably benign
RF061:Chga UTSW 12 102,527,672 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTATAGCTGAGAGCCTGTACC -3'
(R):5'- GCGTCTGCAAACACAAATGG -3'

Sequencing Primer
(F):5'- TGAGAGCCTGTACCCTCAAG -3'
(R):5'- TCCTGAGGCCAAGTTCAATG -3'
Posted On 2019-12-04