Incidental Mutation 'RF058:Haus4'
ID605335
Institutional Source Beutler Lab
Gene Symbol Haus4
Ensembl Gene ENSMUSG00000022177
Gene NameHAUS augmin-like complex, subunit 4
SynonymsD14Ertd500e, 9430093H08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #RF058 (G1)
Quality Score100.467
Status Not validated
Chromosome14
Chromosomal Location54541785-54554616 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) CACTTAAAAAAAAAA to CA at 54550035 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022784] [ENSMUST00000226358]
Predicted Effect probably benign
Transcript: ENSMUST00000022784
SMART Domains Protein: ENSMUSP00000022784
Gene: ENSMUSG00000022177

DomainStartEndE-ValueType
Pfam:HAUS4 126 360 1.5e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226358
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the centrosome complex termed the human augmin complex. The encoded protein localizes to the spindle microtubules and may play a role in mitotic spindle assembly and maintenance of centrosome integrity during cell division. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,780,629 probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,552,887 probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,901 probably benign Het
Alg9 GGC GGCTGC 9: 50,775,427 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Chd4 GC GCTCCCTC 6: 125,122,131 probably benign Het
Chga CAG CAGAAG 12: 102,561,416 probably benign Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,762,177 probably null Het
Gab3 TCT TCTACT X: 75,000,002 probably benign Het
Gabre C CCGGCTG X: 72,270,063 probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,125,817 probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,125,821 probably benign Het
Kri1 TCCTCCTCC TC 9: 21,281,066 probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,262 probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,273,609 probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,941,021 probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 84,956,172 probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,785,318 probably benign Het
Treml1 ACCT A 17: 48,359,947 probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,967,044 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Other mutations in Haus4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01903:Haus4 APN 14 54542429 missense possibly damaging 0.92
R1938:Haus4 UTSW 14 54544276 missense probably damaging 1.00
R4693:Haus4 UTSW 14 54549799 missense probably benign 0.34
R4714:Haus4 UTSW 14 54542120 missense probably benign 0.00
R4754:Haus4 UTSW 14 54549892 critical splice donor site probably null
R4767:Haus4 UTSW 14 54548885 missense probably damaging 0.98
R4835:Haus4 UTSW 14 54545835 splice site probably null
R5230:Haus4 UTSW 14 54543794 missense probably benign 0.12
R5380:Haus4 UTSW 14 54549775 missense probably damaging 1.00
R5888:Haus4 UTSW 14 54544219 missense probably benign 0.00
R6594:Haus4 UTSW 14 54543811 missense possibly damaging 0.95
R7860:Haus4 UTSW 14 54542145 missense probably damaging 0.99
RF044:Haus4 UTSW 14 54544120 frame shift probably null
X0066:Haus4 UTSW 14 54549916 missense probably benign 0.25
Z1177:Haus4 UTSW 14 54549960 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACGGAACCCCTGTCTGAG -3'
(R):5'- ACAGCCAGCAACTCTTTATTTTCG -3'

Sequencing Primer
(F):5'- TGAGGCGGCTTCTCTCTCAAG -3'
(R):5'- GGCACCATCTCACTATGCTG -3'
Posted On2019-12-04