Incidental Mutation 'RF058:Flywch1'
ID 605338
Institutional Source Beutler Lab
Gene Symbol Flywch1
Ensembl Gene ENSMUSG00000040097
Gene Name FLYWCH-type zinc finger 1
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF058 (G1)
Quality Score 217.468
Status Not validated
Chromosome 17
Chromosomal Location 23971767-23990576 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GT to GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT at 23981151 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045517] [ENSMUST00000086325] [ENSMUST00000226460]
AlphaFold Q8CI03
Predicted Effect probably null
Transcript: ENSMUST00000045517
SMART Domains Protein: ENSMUSP00000040022
Gene: ENSMUSG00000040097

DomainStartEndE-ValueType
Pfam:FLYWCH_N 1 83 1.2e-24 PFAM
Pfam:FLYWCH 92 150 7e-17 PFAM
Pfam:FLYWCH 235 293 3.3e-17 PFAM
low complexity region 352 380 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
Pfam:FLYWCH 402 460 9.7e-18 PFAM
Pfam:FLYWCH 490 548 7.9e-18 PFAM
Pfam:FLYWCH 581 639 6.1e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086325
SMART Domains Protein: ENSMUSP00000083505
Gene: ENSMUSG00000040097

DomainStartEndE-ValueType
Pfam:FLYWCH_N 1 84 9.7e-10 PFAM
Pfam:FLYWCH 92 150 3.8e-17 PFAM
Pfam:FLYWCH 235 293 3.1e-17 PFAM
Pfam:FLYWCH_u 294 401 1.3e-30 PFAM
Pfam:FLYWCH 402 460 9.1e-18 PFAM
Pfam:FLYWCH 490 548 6.8e-18 PFAM
Pfam:FLYWCH_u 549 568 9.1e-3 PFAM
Pfam:FLYWCH 581 639 4.7e-17 PFAM
Pfam:FLYWCH_u 640 672 4.6e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226460
Predicted Effect probably null
Transcript: ENSMUST00000227120
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,637,826 (GRCm39) probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,864 (GRCm39) probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,529,850 (GRCm39) probably benign Het
Alg9 GGC GGCTGC 9: 50,686,727 (GRCm39) probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 5,045,858 (GRCm39) probably benign Het
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Het
Chga CAG CAGAAG 12: 102,527,675 (GRCm39) probably benign Het
Cort GCCCACTCGT G 4: 149,209,869 (GRCm39) probably benign Het
Gab3 TCT TCTACT X: 74,043,608 (GRCm39) probably benign Het
Gabre C CCGGCTG X: 71,313,669 (GRCm39) probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,787,492 (GRCm39) probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,179,970 (GRCm39) probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,179,966 (GRCm39) probably benign Het
Kri1 TCCTCCTCC TC 9: 21,192,362 (GRCm39) probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,019,983 (GRCm39) probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,406,680 (GRCm39) probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,891,021 (GRCm39) probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 85,682,801 (GRCm39) probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,384,490 (GRCm39) probably benign Het
Treml1 ACCT A 17: 48,666,975 (GRCm39) probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,851,244 (GRCm39) probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,899,735 (GRCm39) probably benign Het
Other mutations in Flywch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Flywch1 APN 17 23,982,000 (GRCm39) missense probably benign 0.01
IGL01843:Flywch1 APN 17 23,979,319 (GRCm39) missense possibly damaging 0.89
IGL02110:Flywch1 APN 17 23,982,066 (GRCm39) splice site probably null
IGL02586:Flywch1 APN 17 23,974,676 (GRCm39) missense probably benign 0.04
IGL02870:Flywch1 APN 17 23,974,876 (GRCm39) missense probably damaging 1.00
IGL02877:Flywch1 APN 17 23,979,388 (GRCm39) missense probably damaging 1.00
lubdub UTSW 17 23,980,033 (GRCm39) missense possibly damaging 0.93
R0830:Flywch1 UTSW 17 23,981,344 (GRCm39) missense probably benign 0.00
R1411:Flywch1 UTSW 17 23,974,798 (GRCm39) missense probably damaging 1.00
R2044:Flywch1 UTSW 17 23,981,287 (GRCm39) nonsense probably null
R2153:Flywch1 UTSW 17 23,974,624 (GRCm39) missense probably benign 0.21
R2314:Flywch1 UTSW 17 23,982,000 (GRCm39) missense probably benign 0.01
R2497:Flywch1 UTSW 17 23,974,685 (GRCm39) missense probably benign 0.27
R3022:Flywch1 UTSW 17 23,982,082 (GRCm39) missense probably benign 0.00
R3625:Flywch1 UTSW 17 23,979,175 (GRCm39) splice site probably benign
R3691:Flywch1 UTSW 17 23,982,186 (GRCm39) missense probably damaging 0.96
R4805:Flywch1 UTSW 17 23,979,591 (GRCm39) missense probably benign 0.16
R5321:Flywch1 UTSW 17 23,975,625 (GRCm39) missense probably damaging 1.00
R7148:Flywch1 UTSW 17 23,974,649 (GRCm39) missense probably benign 0.01
R7200:Flywch1 UTSW 17 23,980,033 (GRCm39) missense possibly damaging 0.93
R7629:Flywch1 UTSW 17 23,974,744 (GRCm39) missense probably benign 0.06
R8362:Flywch1 UTSW 17 23,975,682 (GRCm39) missense probably damaging 1.00
R8762:Flywch1 UTSW 17 23,975,731 (GRCm39) missense probably damaging 1.00
RF003:Flywch1 UTSW 17 23,981,140 (GRCm39) frame shift probably null
RF007:Flywch1 UTSW 17 23,981,145 (GRCm39) frame shift probably null
RF007:Flywch1 UTSW 17 23,981,138 (GRCm39) frame shift probably null
RF009:Flywch1 UTSW 17 23,981,135 (GRCm39) frame shift probably null
RF010:Flywch1 UTSW 17 23,981,149 (GRCm39) frame shift probably null
RF013:Flywch1 UTSW 17 23,981,149 (GRCm39) frame shift probably null
RF018:Flywch1 UTSW 17 23,981,140 (GRCm39) frame shift probably null
RF022:Flywch1 UTSW 17 23,981,141 (GRCm39) frame shift probably null
RF027:Flywch1 UTSW 17 23,981,132 (GRCm39) frame shift probably null
RF031:Flywch1 UTSW 17 23,981,132 (GRCm39) frame shift probably null
RF038:Flywch1 UTSW 17 23,981,138 (GRCm39) frame shift probably null
RF040:Flywch1 UTSW 17 23,981,143 (GRCm39) frame shift probably null
RF041:Flywch1 UTSW 17 23,981,151 (GRCm39) frame shift probably null
RF041:Flywch1 UTSW 17 23,981,135 (GRCm39) frame shift probably null
RF046:Flywch1 UTSW 17 23,981,148 (GRCm39) frame shift probably null
RF046:Flywch1 UTSW 17 23,981,143 (GRCm39) frame shift probably null
RF049:Flywch1 UTSW 17 23,981,145 (GRCm39) frame shift probably null
X0009:Flywch1 UTSW 17 23,974,629 (GRCm39) small deletion probably benign
X0028:Flywch1 UTSW 17 23,980,069 (GRCm39) missense probably damaging 1.00
Z1176:Flywch1 UTSW 17 23,979,983 (GRCm39) missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CGTCTGACCTGTGGACTAATG -3'
(R):5'- TTTCGAGTCACAGAGATGCG -3'

Sequencing Primer
(F):5'- CTGACCTGTGGACTAATGTTGTC -3'
(R):5'- TGTCACCCACCTGAGAAGGAG -3'
Posted On 2019-12-04