Incidental Mutation 'RF058:Zfp598'
ID605339
Institutional Source Beutler Lab
Gene Symbol Zfp598
Ensembl Gene ENSMUSG00000041130
Gene Namezinc finger protein 598
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #RF058 (G1)
Quality Score217.468
Status Not validated
Chromosome17
Chromosomal Location24669752-24682015 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) CCCACCACCACAACCACCACCACCACCACCAC to CCCACCACCACCACCACAACCACCACCACCACCACCAC at 24680761 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007236] [ENSMUST00000047179]
Predicted Effect probably benign
Transcript: ENSMUST00000007236
SMART Domains Protein: ENSMUSP00000007236
Gene: ENSMUSG00000007021

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:MARVEL 20 166 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047179
SMART Domains Protein: ENSMUSP00000038367
Gene: ENSMUSG00000041130

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
RING 27 66 4.73e-1 SMART
ZnF_C2H2 115 140 9.46e0 SMART
low complexity region 144 153 N/A INTRINSIC
ZnF_C2H2 185 208 5.2e0 SMART
ZnF_C2H2 209 237 7.11e0 SMART
ZnF_C2H2 238 268 6.47e1 SMART
low complexity region 311 331 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 526 544 N/A INTRINSIC
low complexity region 581 589 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 668 683 N/A INTRINSIC
low complexity region 694 748 N/A INTRINSIC
ZnF_C2H2 869 890 8.84e1 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This protein and Grb10-interacting GYF protein 2 have been identified as a components of the mammalian 4EHP (m4EHP) complex. The complex is thought to function as a translation repressor in embryonic development. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,780,629 probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,552,887 probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,901 probably benign Het
Alg9 GGC GGCTGC 9: 50,775,427 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Chd4 GC GCTCCCTC 6: 125,122,131 probably benign Het
Chga CAG CAGAAG 12: 102,561,416 probably benign Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,762,177 probably null Het
Gab3 TCT TCTACT X: 75,000,002 probably benign Het
Gabre C CCGGCTG X: 72,270,063 probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,550,035 probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,125,817 probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,125,821 probably benign Het
Kri1 TCCTCCTCC TC 9: 21,281,066 probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,262 probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,273,609 probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,941,021 probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 84,956,172 probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,785,318 probably benign Het
Treml1 ACCT A 17: 48,359,947 probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,967,044 probably benign Het
Other mutations in Zfp598
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Zfp598 APN 17 24681424 unclassified probably benign
IGL02118:Zfp598 APN 17 24677617 missense probably damaging 1.00
IGL02178:Zfp598 APN 17 24677543 missense probably damaging 1.00
IGL02591:Zfp598 APN 17 24677504 missense probably damaging 1.00
IGL03061:Zfp598 APN 17 24679592 missense probably benign 0.03
FR4304:Zfp598 UTSW 17 24680775 small insertion probably benign
FR4340:Zfp598 UTSW 17 24679372 small deletion probably benign
FR4340:Zfp598 UTSW 17 24680783 small insertion probably benign
FR4342:Zfp598 UTSW 17 24680780 small insertion probably benign
FR4449:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4449:Zfp598 UTSW 17 24680785 small insertion probably benign
FR4548:Zfp598 UTSW 17 24680775 small insertion probably benign
FR4548:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4589:Zfp598 UTSW 17 24680779 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680782 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680791 small insertion probably benign
FR4976:Zfp598 UTSW 17 24679372 small deletion probably benign
FR4976:Zfp598 UTSW 17 24680782 small insertion probably benign
R0309:Zfp598 UTSW 17 24678584 splice site probably benign
R1295:Zfp598 UTSW 17 24679649 missense probably benign 0.00
R1296:Zfp598 UTSW 17 24679649 missense probably benign 0.00
R1471:Zfp598 UTSW 17 24680072 missense probably benign 0.00
R1523:Zfp598 UTSW 17 24678629 missense probably null 1.00
R1819:Zfp598 UTSW 17 24681130 unclassified probably benign
R2001:Zfp598 UTSW 17 24669924 missense possibly damaging 0.94
R2080:Zfp598 UTSW 17 24679667 missense probably damaging 1.00
R4447:Zfp598 UTSW 17 24676555 missense probably damaging 1.00
R5086:Zfp598 UTSW 17 24680898 unclassified probably benign
R5923:Zfp598 UTSW 17 24677549 missense probably damaging 1.00
R6191:Zfp598 UTSW 17 24677876 missense possibly damaging 0.89
R6680:Zfp598 UTSW 17 24678686 missense probably benign 0.06
R7438:Zfp598 UTSW 17 24677530 missense probably damaging 1.00
R7870:Zfp598 UTSW 17 24679330 missense probably damaging 0.98
RF009:Zfp598 UTSW 17 24680787 small insertion probably benign
RF016:Zfp598 UTSW 17 24680771 small insertion probably benign
RF018:Zfp598 UTSW 17 24680771 small insertion probably benign
RF053:Zfp598 UTSW 17 24680761 small insertion probably benign
RF061:Zfp598 UTSW 17 24680770 small insertion probably benign
RF064:Zfp598 UTSW 17 24680783 small insertion probably benign
Z1088:Zfp598 UTSW 17 24680210 small insertion probably benign
Z1177:Zfp598 UTSW 17 24679639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTTGGGATCACACTGAAGC -3'
(R):5'- CATCGCTTTGCAGAAAGTCC -3'

Sequencing Primer
(F):5'- GGGATCACACTGAAGCTCTTATGTC -3'
(R):5'- CCTTGATAGACTGGATAAGCTGC -3'
Posted On2019-12-04