Incidental Mutation 'RF058:Treml1'
ID605340
Institutional Source Beutler Lab
Gene Symbol Treml1
Ensembl Gene ENSMUSG00000023993
Gene Nametriggering receptor expressed on myeloid cells-like 1
Synonyms5430401J17Rik, TLT-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF058 (G1)
Quality Score102.467
Status Not validated
Chromosome17
Chromosomal Location48359916-48367176 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) ACCT to A at 48359947 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024792] [ENSMUST00000223956] [ENSMUST00000224001] [ENSMUST00000225849]
Predicted Effect probably null
Transcript: ENSMUST00000024792
SMART Domains Protein: ENSMUSP00000024792
Gene: ENSMUSG00000023993

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 24 124 2.83e-3 SMART
transmembrane domain 179 201 N/A INTRINSIC
low complexity region 260 280 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000223956
Predicted Effect probably null
Transcript: ENSMUST00000224001
Predicted Effect probably null
Transcript: ENSMUST00000225849
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the triggering receptor expressed on myeloid cells-like (TREM) family. The encoded protein is a type 1 single Ig domain orphan receptor localized to the alpha-granule membranes of platelets. The encoded protein is involved in platelet aggregation, inflammation, and cellular activation and has been linked to Gray platelet syndrome. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduced platelet count, defective platelet aggregation, prolonged bleeding times, enhanced inflammatory hemorrhage, and increased susceptibility to death from endotoxin (LPS) challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,780,629 probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,552,887 probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,901 probably benign Het
Alg9 GGC GGCTGC 9: 50,775,427 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Chd4 GC GCTCCCTC 6: 125,122,131 probably benign Het
Chga CAG CAGAAG 12: 102,561,416 probably benign Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,762,177 probably null Het
Gab3 TCT TCTACT X: 75,000,002 probably benign Het
Gabre C CCGGCTG X: 72,270,063 probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,550,035 probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,125,817 probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,125,821 probably benign Het
Kri1 TCCTCCTCC TC 9: 21,281,066 probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,262 probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,273,609 probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,941,021 probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 84,956,172 probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,785,318 probably benign Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,967,044 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Other mutations in Treml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Treml1 APN 17 48365599 splice site probably benign
IGL01868:Treml1 APN 17 48366007 missense probably benign 0.41
IGL02543:Treml1 APN 17 48360431 missense possibly damaging 0.93
IGL03136:Treml1 APN 17 48364851 splice site probably benign
IGL03242:Treml1 APN 17 48365988 splice site probably benign
R0047:Treml1 UTSW 17 48364980 nonsense probably null
R0047:Treml1 UTSW 17 48364980 nonsense probably null
R0226:Treml1 UTSW 17 48360458 missense probably damaging 0.99
R1385:Treml1 UTSW 17 48360198 missense probably damaging 1.00
R1602:Treml1 UTSW 17 48364889 missense probably damaging 0.97
R4379:Treml1 UTSW 17 48360396 missense probably damaging 1.00
R4865:Treml1 UTSW 17 48366857 missense probably benign 0.00
R5837:Treml1 UTSW 17 48360152 missense possibly damaging 0.74
R7102:Treml1 UTSW 17 48366672 missense probably damaging 0.98
R7107:Treml1 UTSW 17 48360219 missense probably damaging 1.00
R7442:Treml1 UTSW 17 48366691 missense probably damaging 1.00
R7825:Treml1 UTSW 17 48366756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCTGAACCTTGAGCCAAG -3'
(R):5'- CTAGAATGGATGACCCCACC -3'

Sequencing Primer
(F):5'- ACCTTGAGCCAAGAAATCTATGG -3'
(R):5'- ATGACTGTCAGCTGAGCCTTG -3'
Posted On2019-12-04