Incidental Mutation 'RF058:Treml1'
ID 605340
Institutional Source Beutler Lab
Gene Symbol Treml1
Ensembl Gene ENSMUSG00000023993
Gene Name triggering receptor expressed on myeloid cells-like 1
Synonyms TLT-1, 5430401J17Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF058 (G1)
Quality Score 102.467
Status Not validated
Chromosome 17
Chromosomal Location 48666944-48674204 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) ACCT to A at 48666975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024792] [ENSMUST00000223956] [ENSMUST00000224001] [ENSMUST00000225849]
AlphaFold Q8K558
Predicted Effect probably null
Transcript: ENSMUST00000024792
SMART Domains Protein: ENSMUSP00000024792
Gene: ENSMUSG00000023993

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 24 124 2.83e-3 SMART
transmembrane domain 179 201 N/A INTRINSIC
low complexity region 260 280 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000223956
Predicted Effect probably null
Transcript: ENSMUST00000224001
Predicted Effect probably null
Transcript: ENSMUST00000225849
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the triggering receptor expressed on myeloid cells-like (TREM) family. The encoded protein is a type 1 single Ig domain orphan receptor localized to the alpha-granule membranes of platelets. The encoded protein is involved in platelet aggregation, inflammation, and cellular activation and has been linked to Gray platelet syndrome. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduced platelet count, defective platelet aggregation, prolonged bleeding times, enhanced inflammatory hemorrhage, and increased susceptibility to death from endotoxin (LPS) challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,637,826 (GRCm39) probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,529,850 (GRCm39) probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,864 (GRCm39) probably benign Het
Alg9 GGC GGCTGC 9: 50,686,727 (GRCm39) probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 5,045,858 (GRCm39) probably benign Het
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Het
Chga CAG CAGAAG 12: 102,527,675 (GRCm39) probably benign Het
Cort GCCCACTCGT G 4: 149,209,869 (GRCm39) probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,981,151 (GRCm39) probably null Het
Gab3 TCT TCTACT X: 74,043,608 (GRCm39) probably benign Het
Gabre C CCGGCTG X: 71,313,669 (GRCm39) probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,787,492 (GRCm39) probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,179,970 (GRCm39) probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,179,966 (GRCm39) probably benign Het
Kri1 TCCTCCTCC TC 9: 21,192,362 (GRCm39) probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,019,983 (GRCm39) probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,406,680 (GRCm39) probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,891,021 (GRCm39) probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 85,682,801 (GRCm39) probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,384,490 (GRCm39) probably benign Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,851,244 (GRCm39) probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,899,735 (GRCm39) probably benign Het
Other mutations in Treml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Treml1 APN 17 48,672,627 (GRCm39) splice site probably benign
IGL01868:Treml1 APN 17 48,673,035 (GRCm39) missense probably benign 0.41
IGL02543:Treml1 APN 17 48,667,459 (GRCm39) missense possibly damaging 0.93
IGL03136:Treml1 APN 17 48,671,879 (GRCm39) splice site probably benign
IGL03242:Treml1 APN 17 48,673,016 (GRCm39) splice site probably benign
R0047:Treml1 UTSW 17 48,672,008 (GRCm39) nonsense probably null
R0047:Treml1 UTSW 17 48,672,008 (GRCm39) nonsense probably null
R0226:Treml1 UTSW 17 48,667,486 (GRCm39) missense probably damaging 0.99
R1385:Treml1 UTSW 17 48,667,226 (GRCm39) missense probably damaging 1.00
R1602:Treml1 UTSW 17 48,671,917 (GRCm39) missense probably damaging 0.97
R4379:Treml1 UTSW 17 48,667,424 (GRCm39) missense probably damaging 1.00
R4865:Treml1 UTSW 17 48,673,885 (GRCm39) missense probably benign 0.00
R5837:Treml1 UTSW 17 48,667,180 (GRCm39) missense possibly damaging 0.74
R7102:Treml1 UTSW 17 48,673,700 (GRCm39) missense probably damaging 0.98
R7107:Treml1 UTSW 17 48,667,247 (GRCm39) missense probably damaging 1.00
R7442:Treml1 UTSW 17 48,673,719 (GRCm39) missense probably damaging 1.00
R7825:Treml1 UTSW 17 48,673,784 (GRCm39) missense probably damaging 1.00
R8843:Treml1 UTSW 17 48,673,852 (GRCm39) missense probably damaging 1.00
R8997:Treml1 UTSW 17 48,667,466 (GRCm39) missense probably damaging 1.00
R9229:Treml1 UTSW 17 48,673,774 (GRCm39) missense probably benign
R9510:Treml1 UTSW 17 48,673,771 (GRCm39) missense probably damaging 0.96
R9619:Treml1 UTSW 17 48,672,006 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCTTCTGAACCTTGAGCCAAG -3'
(R):5'- CTAGAATGGATGACCCCACC -3'

Sequencing Primer
(F):5'- ACCTTGAGCCAAGAAATCTATGG -3'
(R):5'- ATGACTGTCAGCTGAGCCTTG -3'
Posted On 2019-12-04