Incidental Mutation 'RF058:Mbd1'
ID605341
Institutional Source Beutler Lab
Gene Symbol Mbd1
Ensembl Gene ENSMUSG00000024561
Gene Namemethyl-CpG binding domain protein 1
SynonymsPCM1, Cxxc3
Accession Numbers

NCBI RefSeq: NM_013594.2; MGI:1333811

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF058 (G1)
Quality Score217.468
Status Not validated
Chromosome18
Chromosomal Location74267605-74282732 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGTCTTCGTCTGCATCTGCATCTGCA to C at 74273609 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097530] [ENSMUST00000224047] [ENSMUST00000224332]
Predicted Effect probably null
Transcript: ENSMUST00000097530
SMART Domains Protein: ENSMUSP00000095137
Gene: ENSMUSG00000024561

DomainStartEndE-ValueType
MBD 3 76 3.94e-27 SMART
low complexity region 82 97 N/A INTRINSIC
low complexity region 123 153 N/A INTRINSIC
Pfam:zf-CXXC 194 241 1.9e-13 PFAM
Pfam:zf-CXXC 243 288 1.2e-13 PFAM
low complexity region 358 368 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224047
Predicted Effect probably null
Transcript: ENSMUST00000224332
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype Strain: 2664084
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains multiple domains: MBD at the N-terminus that functions both in binding to methylated DNA and in protein interactions; several CXXC-type zinc finger domains that mediate binding to non-methylated CpG dinucleotides; transcriptional repression domain (TRD) at the C-terminus that is involved in transcription repression and in protein interactions. Numerous alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null exhibited defects in adult hippocampal neurogenesis and function. Spatial learning was also impaired in mutant mice. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,780,629 probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,552,887 probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,901 probably benign Het
Alg9 GGC GGCTGC 9: 50,775,427 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Chd4 GC GCTCCCTC 6: 125,122,131 probably benign Het
Chga CAG CAGAAG 12: 102,561,416 probably benign Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,762,177 probably null Het
Gab3 TCT TCTACT X: 75,000,002 probably benign Het
Gabre C CCGGCTG X: 72,270,063 probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,550,035 probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,125,817 probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,125,821 probably benign Het
Kri1 TCCTCCTCC TC 9: 21,281,066 probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,262 probably benign Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,941,021 probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 84,956,172 probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,785,318 probably benign Het
Treml1 ACCT A 17: 48,359,947 probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,967,044 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Other mutations in Mbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Mbd1 APN 18 74275239 missense possibly damaging 0.72
IGL01551:Mbd1 APN 18 74269543 unclassified probably benign
IGL02213:Mbd1 APN 18 74275382 missense probably damaging 1.00
IGL02562:Mbd1 APN 18 74276922 missense probably benign 0.00
IGL02596:Mbd1 APN 18 74276797 splice site probably benign
IGL02944:Mbd1 APN 18 74277410 missense probably damaging 1.00
IGL02973:Mbd1 APN 18 74275427 splice site probably benign
IGL03200:Mbd1 APN 18 74276431 missense probably benign 0.02
IGL03247:Mbd1 APN 18 74274754 nonsense probably null
IGL03340:Mbd1 APN 18 74274482 missense probably benign 0.00
Shortbread UTSW 18 74274057 critical splice donor site probably null
FR4737:Mbd1 UTSW 18 74273573 small deletion probably benign
P0016:Mbd1 UTSW 18 74274538 nonsense probably null
R0385:Mbd1 UTSW 18 74273241 frame shift probably null
R0630:Mbd1 UTSW 18 74276727 splice site probably benign
R0717:Mbd1 UTSW 18 74273597 missense possibly damaging 0.89
R1084:Mbd1 UTSW 18 74269532 missense probably damaging 1.00
R1290:Mbd1 UTSW 18 74269486 missense possibly damaging 0.59
R1575:Mbd1 UTSW 18 74275419 critical splice donor site probably null
R2065:Mbd1 UTSW 18 74276884 missense probably damaging 1.00
R2192:Mbd1 UTSW 18 74277378 missense probably damaging 0.99
R2308:Mbd1 UTSW 18 74276477 missense probably benign 0.42
R2697:Mbd1 UTSW 18 74273617 missense possibly damaging 0.95
R3407:Mbd1 UTSW 18 74277367 missense possibly damaging 0.94
R4348:Mbd1 UTSW 18 74274416 missense probably damaging 1.00
R4664:Mbd1 UTSW 18 74269526 missense possibly damaging 0.86
R5460:Mbd1 UTSW 18 74269510 missense probably benign 0.03
R5860:Mbd1 UTSW 18 74276697 nonsense probably null
R6431:Mbd1 UTSW 18 74273691 splice site probably null
R6734:Mbd1 UTSW 18 74276043 missense probably damaging 1.00
R6861:Mbd1 UTSW 18 74273574
R7363:Mbd1 UTSW 18 74273286 missense probably damaging 0.97
R7543:Mbd1 UTSW 18 74274449 missense probably damaging 0.97
R7657:Mbd1 UTSW 18 74274733 missense probably damaging 0.99
R7871:Mbd1 UTSW 18 74274057 critical splice donor site probably null
RF005:Mbd1 UTSW 18 74273573 small deletion probably benign
RF011:Mbd1 UTSW 18 74273610 small deletion probably benign
RF024:Mbd1 UTSW 18 74273573 small deletion probably benign
RF024:Mbd1 UTSW 18 74273610 small deletion probably benign
Z1177:Mbd1 UTSW 18 74276939 missense probably null 0.72
Predicted Primers PCR Primer
(F):5'- TCAGACTCATCCCTTGGCTG -3'
(R):5'- TCTTTGCACAACGTCTTAAGTC -3'

Sequencing Primer
(F):5'- TGTCCCCAGCAAGAAGAAAAAG -3'
(R):5'- GCACAACGTCTTAAGTCTCTGC -3'
Posted On2019-12-04