Incidental Mutation 'RF058:Gabre'
ID605342
Institutional Source Beutler Lab
Gene Symbol Gabre
Ensembl Gene ENSMUSG00000031340
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit epsilon
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF058 (G1)
Quality Score214.461
Status Not validated
ChromosomeX
Chromosomal Location72255999-72274803 bp(-) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) C to CCGGCTG at 72270063 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064780]
Predicted Effect probably benign
Transcript: ENSMUST00000064780
SMART Domains Protein: ENSMUSP00000066543
Gene: ENSMUSG00000031340

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 40 55 N/A INTRINSIC
low complexity region 83 169 N/A INTRINSIC
low complexity region 173 219 N/A INTRINSIC
low complexity region 234 441 N/A INTRINSIC
Pfam:Neur_chan_LBD 482 688 1.4e-47 PFAM
Pfam:Neur_chan_memb 695 856 2.1e-23 PFAM
transmembrane domain 892 914 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,780,629 probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,552,887 probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,901 probably benign Het
Alg9 GGC GGCTGC 9: 50,775,427 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Chd4 GC GCTCCCTC 6: 125,122,131 probably benign Het
Chga CAG CAGAAG 12: 102,561,416 probably benign Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,762,177 probably null Het
Gab3 TCT TCTACT X: 75,000,002 probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,550,035 probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,125,817 probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,125,821 probably benign Het
Kri1 TCCTCCTCC TC 9: 21,281,066 probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,262 probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,273,609 probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,941,021 probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 84,956,172 probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,785,318 probably benign Het
Treml1 ACCT A 17: 48,359,947 probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,967,044 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Other mutations in Gabre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Gabre APN X 72274653 nonsense probably null
FR4304:Gabre UTSW X 72270042 small insertion probably benign
FR4589:Gabre UTSW X 72270030 small insertion probably benign
FR4589:Gabre UTSW X 72270042 small insertion probably benign
FR4976:Gabre UTSW X 72270418 small insertion probably benign
FR4976:Gabre UTSW X 72270422 small insertion probably benign
R7620:Gabre UTSW X 72270259 missense unknown
RF002:Gabre UTSW X 72270057 nonsense probably null
RF005:Gabre UTSW X 72270045 nonsense probably null
RF009:Gabre UTSW X 72270712 small deletion probably benign
RF009:Gabre UTSW X 72270713 small insertion probably benign
RF010:Gabre UTSW X 72270060 small insertion probably benign
RF013:Gabre UTSW X 72270416 small insertion probably benign
RF023:Gabre UTSW X 72270054 small insertion probably benign
RF024:Gabre UTSW X 72270177 frame shift probably null
RF028:Gabre UTSW X 72270763 small insertion probably benign
RF029:Gabre UTSW X 72270059 small insertion probably benign
RF034:Gabre UTSW X 72270762 small insertion probably benign
RF037:Gabre UTSW X 72270061 small insertion probably benign
RF041:Gabre UTSW X 72270049 small insertion probably benign
RF042:Gabre UTSW X 72270047 small insertion probably benign
RF043:Gabre UTSW X 72270048 small insertion probably benign
RF044:Gabre UTSW X 72270061 small insertion probably benign
RF045:Gabre UTSW X 72270045 small insertion probably benign
RF045:Gabre UTSW X 72270181 frame shift probably null
RF047:Gabre UTSW X 72270053 small insertion probably benign
RF047:Gabre UTSW X 72270765 nonsense probably null
RF049:Gabre UTSW X 72270277 frame shift probably null
RF050:Gabre UTSW X 72270741 nonsense probably null
RF051:Gabre UTSW X 72270049 small insertion probably benign
RF052:Gabre UTSW X 72270047 small insertion probably benign
RF054:Gabre UTSW X 72270416 small insertion probably benign
RF055:Gabre UTSW X 72270177 frame shift probably null
RF059:Gabre UTSW X 72270764 small insertion probably benign
RF061:Gabre UTSW X 72270048 small insertion probably benign
RF064:Gabre UTSW X 72270063 nonsense probably null
RF064:Gabre UTSW X 72270171 frame shift probably null
X0018:Gabre UTSW X 72270338 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGGGACTGGGGCTCTGA -3'
(R):5'- CTCAGCCTCAGCCTCTGG -3'

Sequencing Primer
(F):5'- ACTGGGGCTCTGATTTCATC -3'
(R):5'- TCAGCCTGAGCCACAGC -3'
Posted On2019-12-04