Incidental Mutation 'RF058:Gabre'
ID 605342
Institutional Source Beutler Lab
Gene Symbol Gabre
Ensembl Gene ENSMUSG00000031340
Gene Name gamma-aminobutyric acid (GABA) A receptor, subunit epsilon
Synonyms
Accession Numbers
Essential gene? Not available question?
Stock # RF058 (G1)
Quality Score 214.461
Status Not validated
Chromosome X
Chromosomal Location 71300532-71318433 bp(-) (GRCm39)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) C to CCGGCTG at 71313669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064780]
AlphaFold A2AMW3
Predicted Effect probably benign
Transcript: ENSMUST00000064780
SMART Domains Protein: ENSMUSP00000066543
Gene: ENSMUSG00000031340

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 40 55 N/A INTRINSIC
low complexity region 83 169 N/A INTRINSIC
low complexity region 173 219 N/A INTRINSIC
low complexity region 234 441 N/A INTRINSIC
Pfam:Neur_chan_LBD 482 688 1.4e-47 PFAM
Pfam:Neur_chan_memb 695 856 2.1e-23 PFAM
transmembrane domain 892 914 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,637,826 (GRCm39) probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,529,850 (GRCm39) probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,864 (GRCm39) probably benign Het
Alg9 GGC GGCTGC 9: 50,686,727 (GRCm39) probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 5,045,858 (GRCm39) probably benign Het
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Het
Chga CAG CAGAAG 12: 102,527,675 (GRCm39) probably benign Het
Cort GCCCACTCGT G 4: 149,209,869 (GRCm39) probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,981,151 (GRCm39) probably null Het
Gab3 TCT TCTACT X: 74,043,608 (GRCm39) probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,787,492 (GRCm39) probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,179,970 (GRCm39) probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,179,966 (GRCm39) probably benign Het
Kri1 TCCTCCTCC TC 9: 21,192,362 (GRCm39) probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,019,983 (GRCm39) probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,406,680 (GRCm39) probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,891,021 (GRCm39) probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 85,682,801 (GRCm39) probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,384,490 (GRCm39) probably benign Het
Treml1 ACCT A 17: 48,666,975 (GRCm39) probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,851,244 (GRCm39) probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,899,735 (GRCm39) probably benign Het
Other mutations in Gabre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Gabre APN X 71,318,259 (GRCm39) nonsense probably null
FR4304:Gabre UTSW X 71,313,648 (GRCm39) small insertion probably benign
FR4589:Gabre UTSW X 71,313,648 (GRCm39) small insertion probably benign
FR4589:Gabre UTSW X 71,313,636 (GRCm39) small insertion probably benign
FR4976:Gabre UTSW X 71,314,028 (GRCm39) small insertion probably benign
FR4976:Gabre UTSW X 71,314,024 (GRCm39) small insertion probably benign
R7620:Gabre UTSW X 71,313,865 (GRCm39) missense unknown
RF002:Gabre UTSW X 71,313,663 (GRCm39) nonsense probably null
RF005:Gabre UTSW X 71,313,651 (GRCm39) nonsense probably null
RF009:Gabre UTSW X 71,314,319 (GRCm39) small insertion probably benign
RF009:Gabre UTSW X 71,314,318 (GRCm39) small deletion probably benign
RF010:Gabre UTSW X 71,313,666 (GRCm39) small insertion probably benign
RF013:Gabre UTSW X 71,314,022 (GRCm39) small insertion probably benign
RF023:Gabre UTSW X 71,313,660 (GRCm39) small insertion probably benign
RF024:Gabre UTSW X 71,313,783 (GRCm39) frame shift probably null
RF028:Gabre UTSW X 71,314,369 (GRCm39) small insertion probably benign
RF029:Gabre UTSW X 71,313,665 (GRCm39) small insertion probably benign
RF034:Gabre UTSW X 71,314,368 (GRCm39) small insertion probably benign
RF037:Gabre UTSW X 71,313,667 (GRCm39) small insertion probably benign
RF041:Gabre UTSW X 71,313,655 (GRCm39) small insertion probably benign
RF042:Gabre UTSW X 71,313,653 (GRCm39) small insertion probably benign
RF043:Gabre UTSW X 71,313,654 (GRCm39) small insertion probably benign
RF044:Gabre UTSW X 71,313,667 (GRCm39) small insertion probably benign
RF045:Gabre UTSW X 71,313,787 (GRCm39) frame shift probably null
RF045:Gabre UTSW X 71,313,651 (GRCm39) small insertion probably benign
RF047:Gabre UTSW X 71,314,371 (GRCm39) nonsense probably null
RF047:Gabre UTSW X 71,313,659 (GRCm39) small insertion probably benign
RF049:Gabre UTSW X 71,313,883 (GRCm39) frame shift probably null
RF050:Gabre UTSW X 71,314,347 (GRCm39) nonsense probably null
RF051:Gabre UTSW X 71,313,655 (GRCm39) small insertion probably benign
RF052:Gabre UTSW X 71,313,653 (GRCm39) small insertion probably benign
RF054:Gabre UTSW X 71,314,022 (GRCm39) small insertion probably benign
RF055:Gabre UTSW X 71,313,783 (GRCm39) frame shift probably null
RF059:Gabre UTSW X 71,314,370 (GRCm39) small insertion probably benign
RF061:Gabre UTSW X 71,313,654 (GRCm39) small insertion probably benign
RF064:Gabre UTSW X 71,313,777 (GRCm39) frame shift probably null
RF064:Gabre UTSW X 71,313,669 (GRCm39) nonsense probably null
X0018:Gabre UTSW X 71,313,944 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTGGGACTGGGGCTCTGA -3'
(R):5'- CTCAGCCTCAGCCTCTGG -3'

Sequencing Primer
(F):5'- ACTGGGGCTCTGATTTCATC -3'
(R):5'- TCAGCCTGAGCCACAGC -3'
Posted On 2019-12-04