Incidental Mutation 'RF059:Lce1m'
ID 605348
Institutional Source Beutler Lab
Gene Symbol Lce1m
Ensembl Gene ENSMUSG00000027912
Gene Name late cornified envelope 1M
Synonyms Sprrl10, Lce5a, 1110059L13Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock # RF059 (G1)
Quality Score 169.468
Status Not validated
Chromosome 3
Chromosomal Location 93017810-93019060 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) GCTGCTGCCACCGCTGCTGCCACCGCTGCTGCCACAGCAACTGCTGCCACCGCTGCTGCCAC to GCTGCTGCCACCGCTGCTGCCAC at 93018329 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
AlphaFold Q9CR91
Predicted Effect probably benign
Transcript: ENSMUST00000029520
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912

DomainStartEndE-ValueType
Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029521
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
low complexity region 12 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107301
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193944
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.6%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik CTGTGGCTG CTGTGGCTGGTGTGGCTG 1: 82,913,579 probably benign Het
AY761185 CTGTGGGCACTT CT 8: 20,943,914 probably null Het
Cherp GACCTGGA G 8: 72,462,055 probably null Het
Cpox C T 16: 58,670,767 R114C probably benign Het
Cyb5r4 GGGA GGGATGTGACAGACACACTGCCCAAGGA 9: 87,040,445 probably benign Het
Dnmt1 ACCTCGTT ACCTCGTTTTGGGGGCGGAGCACAGTTCCTCCCTCGTT 9: 20,910,138 probably benign Het
Dnmt1 CCTCGTT CCTCGTTTTGGGGGCGGAGCACAGTTCCTATCTCGTT 9: 20,910,139 probably null Het
Gab3 TCT TCTGCT X: 74,999,990 probably benign Het
Gabre TC TCTGGCAC X: 72,270,764 probably benign Het
Hsdl2 G GCAGCAGCCACAGCTGCAA 4: 59,610,658 probably benign Het
Klra2 GAAAGAAATCCA GAAAGAAATCCAAAGAAATCCA 6: 131,221,838 probably null Het
Kmt2c CCTTCT CCT 5: 25,313,479 probably benign Het
Krtap28-10 CCACAGCCACCACAG CCACAGCCACCACAGACACAGCCACCACAG 1: 83,042,275 probably benign Het
Krtap28-10 C CCACAGCCACCACAGA 1: 83,042,290 probably benign Het
Lca5l TGGCCCTGGCCCCGGCCC TGGCCC 16: 96,159,301 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,832 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Sbp GACAACAAAGATG GACAACAAAGATGCTTACAACAAAGATG 17: 23,945,377 probably benign Het
Sprr2b ATGCTGTGAGCCTTGTCCTCCTCCAAAGTGC ATGC 3: 92,317,568 probably benign Het
Other mutations in Lce1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Lce1m UTSW 3 93018247 unclassified probably benign
FR4449:Lce1m UTSW 3 93018152 unclassified probably benign
FR4589:Lce1m UTSW 3 93018268 unclassified probably benign
FR4976:Lce1m UTSW 3 93018148 unclassified probably benign
R1513:Lce1m UTSW 3 93018625 unclassified probably benign
R7621:Lce1m UTSW 3 93017870 splice site probably null
R7753:Lce1m UTSW 3 93018508 missense unknown
RF001:Lce1m UTSW 3 93018152 unclassified probably benign
RF001:Lce1m UTSW 3 93018269 unclassified probably benign
RF002:Lce1m UTSW 3 93018283 unclassified probably benign
RF002:Lce1m UTSW 3 93018299 unclassified probably benign
RF007:Lce1m UTSW 3 93018144 unclassified probably benign
RF009:Lce1m UTSW 3 93018131 unclassified probably benign
RF010:Lce1m UTSW 3 93018290 unclassified probably benign
RF015:Lce1m UTSW 3 93018148 unclassified probably benign
RF021:Lce1m UTSW 3 93018269 unclassified probably benign
RF021:Lce1m UTSW 3 93018295 unclassified probably benign
RF023:Lce1m UTSW 3 93018280 unclassified probably benign
RF026:Lce1m UTSW 3 93018138 unclassified probably benign
RF026:Lce1m UTSW 3 93018143 unclassified probably benign
RF028:Lce1m UTSW 3 93018131 unclassified probably benign
RF030:Lce1m UTSW 3 93018141 unclassified probably benign
RF030:Lce1m UTSW 3 93018344 unclassified probably benign
RF037:Lce1m UTSW 3 93018300 unclassified probably benign
RF041:Lce1m UTSW 3 93018141 unclassified probably benign
RF042:Lce1m UTSW 3 93018139 unclassified probably benign
RF045:Lce1m UTSW 3 93018292 unclassified probably benign
RF046:Lce1m UTSW 3 93018293 unclassified probably benign
RF054:Lce1m UTSW 3 93018298 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGTTCTTCGTGGCCAGGTC -3'
(R):5'- AGATGTCCTGTCAGCAGAGC -3'

Sequencing Primer
(F):5'- CCAGACTGCTGATGGCTG -3'
(R):5'- CCTGCTGTAGCCTGGGTTC -3'
Posted On 2019-12-04