Incidental Mutation 'RF059:Lce1m'
ID605348
Institutional Source Beutler Lab
Gene Symbol Lce1m
Ensembl Gene ENSMUSG00000027912
Gene Namelate cornified envelope 1M
SynonymsSprrl10, Lce5a, 1110059L13Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF059 (G1)
Quality Score169.468
Status Not validated
Chromosome3
Chromosomal Location93017810-93019060 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GCTGCTGCCACCGCTGCTGCCACCGCTGCTGCCACAGCAACTGCTGCCACCGCTGCTGCCAC to GCTGCTGCCACCGCTGCTGCCAC at 93018329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
Predicted Effect probably benign
Transcript: ENSMUST00000029520
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912

DomainStartEndE-ValueType
Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029521
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
low complexity region 12 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107301
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193944
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.6%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik CTGTGGCTG CTGTGGCTGGTGTGGCTG 1: 82,913,579 probably benign Het
AY761185 CTGTGGGCACTT CT 8: 20,943,914 probably null Het
Cherp GACCTGGA G 8: 72,462,055 probably null Het
Cpox C T 16: 58,670,767 R114C probably benign Het
Cyb5r4 GGGA GGGATGTGACAGACACACTGCCCAAGGA 9: 87,040,445 probably benign Het
Dnmt1 CCTCGTT CCTCGTTTTGGGGGCGGAGCACAGTTCCTATCTCGTT 9: 20,910,139 probably null Het
Dnmt1 ACCTCGTT ACCTCGTTTTGGGGGCGGAGCACAGTTCCTCCCTCGTT 9: 20,910,138 probably benign Het
Gab3 TCT TCTGCT X: 74,999,990 probably benign Het
Gabre TC TCTGGCAC X: 72,270,764 probably benign Het
Hsdl2 G GCAGCAGCCACAGCTGCAA 4: 59,610,658 probably benign Het
Klra2 GAAAGAAATCCA GAAAGAAATCCAAAGAAATCCA 6: 131,221,838 probably null Het
Kmt2c CCTTCT CCT 5: 25,313,479 probably benign Het
Krtap28-10 CCACAGCCACCACAG CCACAGCCACCACAGACACAGCCACCACAG 1: 83,042,275 probably benign Het
Krtap28-10 C CCACAGCCACCACAGA 1: 83,042,290 probably benign Het
Lca5l TGGCCCTGGCCCCGGCCC TGGCCC 16: 96,159,301 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,832 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Sbp GACAACAAAGATG GACAACAAAGATGCTTACAACAAAGATG 17: 23,945,377 probably benign Het
Sprr2b ATGCTGTGAGCCTTGTCCTCCTCCAAAGTGC ATGC 3: 92,317,568 probably benign Het
Other mutations in Lce1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Lce1m UTSW 3 93018247 unclassified probably benign
FR4449:Lce1m UTSW 3 93018152 unclassified probably benign
FR4589:Lce1m UTSW 3 93018268 unclassified probably benign
FR4976:Lce1m UTSW 3 93018148 unclassified probably benign
R1513:Lce1m UTSW 3 93018625 unclassified probably benign
R7621:Lce1m UTSW 3 93017870 utr 3 prime probably null
R7753:Lce1m UTSW 3 93018508 missense unknown
RF001:Lce1m UTSW 3 93018152 unclassified probably benign
RF001:Lce1m UTSW 3 93018269 unclassified probably benign
RF002:Lce1m UTSW 3 93018283 unclassified probably benign
RF002:Lce1m UTSW 3 93018299 unclassified probably benign
RF007:Lce1m UTSW 3 93018144 unclassified probably benign
RF009:Lce1m UTSW 3 93018131 unclassified probably benign
RF010:Lce1m UTSW 3 93018290 unclassified probably benign
RF015:Lce1m UTSW 3 93018148 unclassified probably benign
RF021:Lce1m UTSW 3 93018269 unclassified probably benign
RF021:Lce1m UTSW 3 93018295 unclassified probably benign
RF023:Lce1m UTSW 3 93018280 unclassified probably benign
RF026:Lce1m UTSW 3 93018138 unclassified probably benign
RF026:Lce1m UTSW 3 93018143 unclassified probably benign
RF028:Lce1m UTSW 3 93018131 unclassified probably benign
RF030:Lce1m UTSW 3 93018141 unclassified probably benign
RF030:Lce1m UTSW 3 93018344 unclassified probably benign
RF037:Lce1m UTSW 3 93018300 unclassified probably benign
RF041:Lce1m UTSW 3 93018141 unclassified probably benign
RF042:Lce1m UTSW 3 93018139 unclassified probably benign
RF045:Lce1m UTSW 3 93018292 unclassified probably benign
RF046:Lce1m UTSW 3 93018293 unclassified probably benign
RF054:Lce1m UTSW 3 93018298 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGTTCTTCGTGGCCAGGTC -3'
(R):5'- AGATGTCCTGTCAGCAGAGC -3'

Sequencing Primer
(F):5'- CCAGACTGCTGATGGCTG -3'
(R):5'- CCTGCTGTAGCCTGGGTTC -3'
Posted On2019-12-04