Incidental Mutation 'RF060:Cyb5r4'
ID605386
Institutional Source Beutler Lab
Gene Symbol Cyb5r4
Ensembl Gene ENSMUSG00000032872
Gene Namecytochrome b5 reductase 4
Synonymsb5/b5r, Ncb5or, B5+B5R, 2810034J18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF060 (G1)
Quality Score217.468
Status Not validated
Chromosome9
Chromosomal Location87022014-87077774 bp(+) (GRCm38)
Type of Mutationsmall insertion (8 aa in frame mutation)
DNA Base Change (assembly) ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA to ACTGCCCAGGGATCTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA at 87040413 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168529]
Predicted Effect probably benign
Transcript: ENSMUST00000168529
SMART Domains Protein: ENSMUSP00000126119
Gene: ENSMUSG00000032872

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.1e-16 PFAM
Pfam:FAD_binding_6 284 391 4.1e-22 PFAM
Pfam:NAD_binding_1 402 508 4.7e-18 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NCB5OR is a flavohemoprotein that contains functional domains found in both cytochrome b5 (CYB5A; MIM 613218) and CYB5 reductase (CYB5R3; MIM 613213) (Zhu et al., 1999 [PubMed 10611283]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mice exhibit defects in glucose homeostasis and pancreatic abnormalities consistent with symptoms of diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik CTGTGGCTG CTGTGGCTGATGTGGCTG 1: 82,913,579 probably null Het
A030005L19Rik TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG 1: 82,913,396 probably benign Het
A030005L19Rik GCTG GCTGTGGCTTCTG 1: 82,913,587 probably benign Het
Ankhd1 G GTGGCGC 18: 36,560,922 probably benign Het
Cacna1f GAG GAGCAG X: 7,620,060 probably benign Het
Cd109 ATTTATTTAT ATTTATTTATTTCTTTATTTAT 9: 78,712,525 probably benign Het
Chd4 CC CCACTGGC 6: 125,122,145 probably benign Het
Chga GCA GCATCA 12: 102,561,424 probably benign Het
Dnmt1 CGTT CGTTGTGGGGGAGGAGCACAGTTCCTACCTAGTT 9: 20,910,142 probably null Het
Fam171b GC GCCGCAAC 2: 83,812,877 probably benign Het
Fam71e1 GTCTGAGGGAGGA GTCTGAGGGAGGAAGGCTGGATCCTGGATACCTGGTTCTGAGGGAGGA 7: 44,500,525 probably null Het
Fam71e1 GAGGA GAGGAAGGCTGGATCCTGGATACCTGGGTCTGAGGTAGGA 7: 44,500,533 probably null Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Gab3 TTC TTCCTC X: 75,000,013 probably benign Het
Hsdl2 AAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC AAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,608 probably benign Het
Klra10 TGTAGT TGT 6: 130,275,821 probably benign Het
L1td1 GAGGAGGAGGAGGAGGAGGGGGAGGAGGAGAAGGAGGA GAGGAGGA 4: 98,736,794 probably benign Het
Mamld1 CAG CAGTAG X: 71,118,831 probably null Het
Mamld1 AGC AGCCGC X: 71,118,832 probably benign Het
Map1a A AGCTCCAGCTCCAGCTCCAGCTCCAGCTCCC 2: 121,306,318 probably benign Het
Nefh GACTTGGCC GACTTGGCCCCACCTGGGTACTTGGCC 11: 4,941,050 probably benign Het
Nefh CT CTGGGCTTCACCTGGGGATT 11: 4,941,052 probably benign Het
Pdk1 CTGGCCT C 2: 71,873,445 probably benign Het
Pou3f1 GC GCGGCGCC 4: 124,657,809 probably benign Het
Rfx4 T TCTCTCTCTCTCTCTCC 10: 84,858,494 probably benign Het
Spaca1 CTCGCT CTCGCTGTCGCT 4: 34,049,841 probably benign Het
St3gal5 G GCACTC 6: 72,097,852 probably null Het
Stat1 G T 1: 52,152,260 E591D probably benign Het
Tcof1 CAG CAGTAG 18: 60,835,744 probably benign Het
Tcof1 C CAGT 18: 60,835,747 probably benign Het
Tfeb GCA GCACCA 17: 47,786,106 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCAAG 5: 77,016,427 probably benign Het
Tmem59 TTTGTTT TTTGTTTGCTTGTTT 4: 107,190,526 probably benign Het
Zfhx3 G GAAACAGCAA 8: 108,956,088 probably benign Het
Other mutations in Cyb5r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Cyb5r4 APN 9 87059452 critical splice donor site probably null
cello UTSW 9 87029538 nonsense probably null
viol UTSW 9 87059077 critical splice donor site probably null
PIT1430001:Cyb5r4 UTSW 9 87038738 missense probably benign
R0040:Cyb5r4 UTSW 9 87066742 splice site probably null
R0373:Cyb5r4 UTSW 9 87027040 missense probably damaging 0.99
R0755:Cyb5r4 UTSW 9 87029572 missense probably damaging 1.00
R1381:Cyb5r4 UTSW 9 87022233 missense probably benign 0.03
R1488:Cyb5r4 UTSW 9 87029538 nonsense probably null
R1510:Cyb5r4 UTSW 9 87066643 intron probably benign
R1856:Cyb5r4 UTSW 9 87022209 missense possibly damaging 0.61
R1857:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1858:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1870:Cyb5r4 UTSW 9 87040409 missense probably benign 0.00
R1876:Cyb5r4 UTSW 9 87055814 missense probably damaging 1.00
R1959:Cyb5r4 UTSW 9 87055849 missense possibly damaging 0.82
R2036:Cyb5r4 UTSW 9 87042879 splice site probably benign
R2895:Cyb5r4 UTSW 9 87040399 nonsense probably null
R4226:Cyb5r4 UTSW 9 87057229 missense probably damaging 0.99
R4655:Cyb5r4 UTSW 9 87059429 missense probably benign 0.01
R4971:Cyb5r4 UTSW 9 87057171 missense possibly damaging 0.80
R5038:Cyb5r4 UTSW 9 87059077 critical splice donor site probably null
R5155:Cyb5r4 UTSW 9 87040403 missense probably benign 0.08
R5187:Cyb5r4 UTSW 9 87026948 missense possibly damaging 0.92
R5654:Cyb5r4 UTSW 9 87047480 missense probably damaging 0.98
R5659:Cyb5r4 UTSW 9 87055828 missense probably benign 0.22
R5926:Cyb5r4 UTSW 9 87057261 missense probably benign 0.04
R6083:Cyb5r4 UTSW 9 87057168 missense probably damaging 1.00
R6610:Cyb5r4 UTSW 9 87059417 missense probably benign
R7311:Cyb5r4 UTSW 9 87055782 missense probably damaging 1.00
R7662:Cyb5r4 UTSW 9 87027038 missense possibly damaging 0.83
R7748:Cyb5r4 UTSW 9 87032381 missense probably damaging 1.00
R8171:Cyb5r4 UTSW 9 87042810 missense possibly damaging 0.81
R8253:Cyb5r4 UTSW 9 87059055 missense probably damaging 1.00
R8369:Cyb5r4 UTSW 9 87040433 missense probably benign 0.00
RF001:Cyb5r4 UTSW 9 87040416 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF013:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF014:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF024:Cyb5r4 UTSW 9 87040435 small insertion probably benign
RF025:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF026:Cyb5r4 UTSW 9 87040433 small insertion probably benign
RF027:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF031:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF032:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040417 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040447 nonsense probably null
RF036:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF038:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF040:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040411 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF045:Cyb5r4 UTSW 9 87040402 nonsense probably null
RF045:Cyb5r4 UTSW 9 87040447 small insertion probably benign
RF052:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF053:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040414 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF056:Cyb5r4 UTSW 9 87040410 small insertion probably benign
RF059:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF061:Cyb5r4 UTSW 9 87040435 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCACTGGGAGAGAGTAAGCTTTTG -3'
(R):5'- ATGAGGTACTGCAGTTCGTG -3'

Sequencing Primer
(F):5'- AAGAAAATGCTGGTGACAAGGGTTTC -3'
(R):5'- GCAGTTCGTGCGCTAAGC -3'
Posted On2019-12-04