Incidental Mutation 'RF060:Chga'
ID605390
Institutional Source Beutler Lab
Gene Symbol Chga
Ensembl Gene ENSMUSG00000021194
Gene Namechromogranin A
SynonymsChrA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #RF060 (G1)
Quality Score178.468
Status Not validated
Chromosome12
Chromosomal Location102554969-102565028 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GCA to GCATCA at 102561424 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021610]
Predicted Effect probably benign
Transcript: ENSMUST00000021610
SMART Domains Protein: ENSMUSP00000021610
Gene: ENSMUSG00000021194

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Granin 25 95 3e-26 PFAM
Pfam:Granin 87 463 1.7e-95 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the granin family of acidic secretory glycoproteins that are expressed in endocrine cells and neurons. The encoded preproprotein undergoes proteolytic processing to generate multiple functions peptides including pancreastatin, catestatin and serpinin. The encoded protein plays important roles in the neuroendocrine system including regulated secretion of peptide hormones and neurotransmitters. Mice lacking the encoded protein exhibit elevated blood pressure which can be rescued by transgenic expression of the human ortholog. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes and heterozygotes for one allele display hypertension, abnormal plasma and adrenal adrenaline and noradrenaline levels and, in homozygotes, partial embryonic lethality. Homozygotes for a second allele only have elevated urinary adrenaline, noradrenaline and dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG 1: 82,913,396 probably benign Het
A030005L19Rik CTGTGGCTG CTGTGGCTGATGTGGCTG 1: 82,913,579 probably null Het
A030005L19Rik GCTG GCTGTGGCTTCTG 1: 82,913,587 probably benign Het
Ankhd1 G GTGGCGC 18: 36,560,922 probably benign Het
Cacna1f GAG GAGCAG X: 7,620,060 probably benign Het
Cd109 ATTTATTTAT ATTTATTTATTTCTTTATTTAT 9: 78,712,525 probably benign Het
Chd4 CC CCACTGGC 6: 125,122,145 probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATCTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Dnmt1 CGTT CGTTGTGGGGGAGGAGCACAGTTCCTACCTAGTT 9: 20,910,142 probably null Het
Fam171b GC GCCGCAAC 2: 83,812,877 probably benign Het
Fam71e1 GTCTGAGGGAGGA GTCTGAGGGAGGAAGGCTGGATCCTGGATACCTGGTTCTGAGGGAGGA 7: 44,500,525 probably null Het
Fam71e1 GAGGA GAGGAAGGCTGGATCCTGGATACCTGGGTCTGAGGTAGGA 7: 44,500,533 probably null Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Gab3 TTC TTCCTC X: 75,000,013 probably benign Het
Hsdl2 AAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC AAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,608 probably benign Het
Klra10 TGTAGT TGT 6: 130,275,821 probably benign Het
L1td1 GAGGAGGAGGAGGAGGAGGGGGAGGAGGAGAAGGAGGA GAGGAGGA 4: 98,736,794 probably benign Het
Mamld1 CAG CAGTAG X: 71,118,831 probably null Het
Mamld1 AGC AGCCGC X: 71,118,832 probably benign Het
Map1a A AGCTCCAGCTCCAGCTCCAGCTCCAGCTCCC 2: 121,306,318 probably benign Het
Nefh GACTTGGCC GACTTGGCCCCACCTGGGTACTTGGCC 11: 4,941,050 probably benign Het
Nefh CT CTGGGCTTCACCTGGGGATT 11: 4,941,052 probably benign Het
Pdk1 CTGGCCT C 2: 71,873,445 probably benign Het
Pou3f1 GC GCGGCGCC 4: 124,657,809 probably benign Het
Rfx4 T TCTCTCTCTCTCTCTCC 10: 84,858,494 probably benign Het
Spaca1 CTCGCT CTCGCTGTCGCT 4: 34,049,841 probably benign Het
St3gal5 G GCACTC 6: 72,097,852 probably null Het
Stat1 G T 1: 52,152,260 E591D probably benign Het
Tcof1 CAG CAGTAG 18: 60,835,744 probably benign Het
Tcof1 C CAGT 18: 60,835,747 probably benign Het
Tfeb GCA GCACCA 17: 47,786,106 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCAAG 5: 77,016,427 probably benign Het
Tmem59 TTTGTTT TTTGTTTGCTTGTTT 4: 107,190,526 probably benign Het
Zfhx3 G GAAACAGCAA 8: 108,956,088 probably benign Het
Other mutations in Chga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chga APN 12 102562799 missense probably damaging 0.98
IGL02674:Chga APN 12 102562901 missense probably damaging 1.00
FR4589:Chga UTSW 12 102561402 small insertion probably benign
R0018:Chga UTSW 12 102558505 missense probably damaging 0.97
R0463:Chga UTSW 12 102562951 nonsense probably null
R1164:Chga UTSW 12 102563045 missense probably damaging 1.00
R1603:Chga UTSW 12 102564607 splice site probably null
R1727:Chga UTSW 12 102561437 missense possibly damaging 0.85
R1778:Chga UTSW 12 102561700 missense probably benign
R1800:Chga UTSW 12 102555905 missense probably damaging 0.99
R2071:Chga UTSW 12 102562863 missense probably damaging 1.00
R3415:Chga UTSW 12 102562784 missense probably benign 0.00
R3696:Chga UTSW 12 102561465 missense probably damaging 0.98
R5022:Chga UTSW 12 102562837 missense probably damaging 1.00
R5507:Chga UTSW 12 102562609 missense probably benign 0.39
R5959:Chga UTSW 12 102561855 missense probably benign
R7338:Chga UTSW 12 102562841 missense probably damaging 1.00
R7410:Chga UTSW 12 102562607 missense probably benign 0.00
R7694:Chga UTSW 12 102561347 missense probably benign 0.05
R8084:Chga UTSW 12 102562069 missense probably benign 0.29
R8211:Chga UTSW 12 102561419 missense possibly damaging 0.71
RF001:Chga UTSW 12 102561423 small insertion probably benign
RF002:Chga UTSW 12 102561421 small insertion probably benign
RF006:Chga UTSW 12 102561412 small insertion probably benign
RF009:Chga UTSW 12 102561420 small insertion probably benign
RF010:Chga UTSW 12 102561403 small insertion probably benign
RF014:Chga UTSW 12 102561393 small insertion probably benign
RF014:Chga UTSW 12 102561405 small insertion probably benign
RF015:Chga UTSW 12 102561420 small insertion probably benign
RF022:Chga UTSW 12 102561420 small insertion probably benign
RF033:Chga UTSW 12 102561396 small insertion probably benign
RF035:Chga UTSW 12 102561427 small insertion probably benign
RF044:Chga UTSW 12 102561396 small insertion probably benign
RF048:Chga UTSW 12 102561403 small insertion probably benign
RF048:Chga UTSW 12 102561421 small insertion probably benign
RF049:Chga UTSW 12 102561393 small insertion probably benign
RF052:Chga UTSW 12 102561416 small insertion probably benign
RF054:Chga UTSW 12 102561423 small insertion probably benign
RF056:Chga UTSW 12 102561424 small insertion probably benign
RF058:Chga UTSW 12 102561416 small insertion probably benign
RF061:Chga UTSW 12 102561413 small insertion probably benign
RF061:Chga UTSW 12 102561427 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGAGAGCCTGTACCCTCAAG -3'
(R):5'- CGTCTGCAAACACAAATGGATAGG -3'

Sequencing Primer
(F):5'- CTCAAGGGAGGCCTTCAGTGTTAC -3'
(R):5'- TCCTGAGGCCAAGTTCAATG -3'
Posted On2019-12-04