Incidental Mutation 'RF061:Il2'
ID 605402
Institutional Source Beutler Lab
Gene Symbol Il2
Ensembl Gene ENSMUSG00000027720
Gene Name interleukin 2
Synonyms IL-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF061 (G1)
Quality Score 214.458
Status Not validated
Chromosome 3
Chromosomal Location 37174862-37180103 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GGG to GGGGCTTGAAGTGGG at 37179990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029275]
AlphaFold P04351
Predicted Effect probably benign
Transcript: ENSMUST00000029275
SMART Domains Protein: ENSMUSP00000029275
Gene: ENSMUSG00000027720

DomainStartEndE-ValueType
IL2 1 168 4.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

DomainStartEndE-ValueType
Pfam:A_deamin 1 176 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants develop adult onset autoimmune disease, with 50% mortality by 9 weeks due to hemolytic anemia. Survivors develop inflammatory bowl disease/colitis. Immune system dysregulation and CD4+ T-cell overproduction may be responsible. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik ACTT ACTTACTT 8: 125,566,570 (GRCm39) probably null Het
Abi3bp GCCCACGACCC GCCCACGACCCACGACCC 16: 56,447,950 (GRCm39) probably null Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,693,974 (GRCm39) probably benign Het
Ankrd24 GAGGC GAGGCGGAGGCATAGGC 10: 81,479,401 (GRCm39) probably null Het
Bpifb4 A ACCTCCAC 2: 153,799,048 (GRCm39) probably benign Het
Chga CAG CAGAAG 12: 102,527,672 (GRCm39) probably benign Het
Chga G GCAC 12: 102,527,686 (GRCm39) probably benign Het
Cyb5r4 ACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGA 9: 86,922,488 (GRCm39) probably benign Het
Dnmt1 CAGTTCCTACCTCGTT CAGTTCCTACCTCGTTTTGGGGGCGGAGCAAAGTTCCTACCTCGTT 9: 20,821,426 (GRCm39) probably null Het
Fbrsl1 GTGCTGGTGCGT GTGCTGGTGCGTCTGCTGGTGCGT 5: 110,525,997 (GRCm39) probably benign Het
Gabre GCTCCG GCTCCGACTCCG X: 71,313,654 (GRCm39) probably benign Het
Hsdl2 AG AGCAGCAGCCACAGCTGCTG 4: 59,610,657 (GRCm39) probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGACACCACAGC 1: 83,020,002 (GRCm39) probably benign Het
Lrch1 GGTGGTGTTG GG 14: 75,185,007 (GRCm39) probably null Het
Lrch1 GCTGGTGGT G 14: 75,184,995 (GRCm39) probably null Het
Mamld1 AGC AGCCGC X: 70,162,456 (GRCm39) probably benign Het
Map1a TGGCTCCAGCTCCAGCTCCAGCTCCAGCTCC TGGCTCCAGCTCCAGCTCCAGCTCCAGCTCCGGCTCCAGCTCCAGCTCCAGCTCCAGCTCC 2: 121,136,768 (GRCm39) probably benign Het
Or10n7-ps1 GA GATATA 9: 39,598,049 (GRCm39) probably null Het
Pdcd11 AGGAGGAGG AG 19: 47,101,884 (GRCm39) probably null Het
Pknox2 ACACACACACACACACTCAC ACAC 9: 36,820,905 (GRCm39) probably benign Het
Rfx5 A T 3: 94,863,070 (GRCm39) K54I probably damaging Het
Rps19 AAAAAAT AAAAAATAAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 (GRCm39) probably benign Het
Sbp GACAACA GACAACACAGATGCTAACAACA 17: 24,164,351 (GRCm39) probably benign Het
Stab2 CTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 10: 86,702,622 (GRCm39) probably benign Het
Tfeb CAG CAGGAG 17: 48,097,017 (GRCm39) probably benign Het
Trim33 GGCCCCCGC GGC 3: 103,187,533 (GRCm39) probably benign Het
Zfp598 ACAACCAC ACAACCACAACCAC 17: 24,899,744 (GRCm39) probably benign Het
Other mutations in Il2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Il2 APN 3 37,177,156 (GRCm39) missense possibly damaging 0.64
IGL02047:Il2 APN 3 37,180,000 (GRCm39) missense probably benign 0.01
FR4304:Il2 UTSW 3 37,179,975 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,977 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
FR4976:Il2 UTSW 3 37,179,978 (GRCm39) unclassified probably benign
R8805:Il2 UTSW 3 37,177,282 (GRCm39) missense possibly damaging 0.78
R9287:Il2 UTSW 3 37,179,988 (GRCm39) missense probably damaging 0.99
RF001:Il2 UTSW 3 37,179,911 (GRCm39) unclassified probably benign
RF023:Il2 UTSW 3 37,179,969 (GRCm39) unclassified probably benign
RF029:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
RF036:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF038:Il2 UTSW 3 37,179,970 (GRCm39) nonsense probably null
RF039:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF041:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF043:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF051:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,966 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,970 (GRCm39) unclassified probably benign
RF064:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGGCAAGAAAGCTAAAGGTATTGC -3'
(R):5'- GCCACACAGGTAGACTCTTTG -3'

Sequencing Primer
(F):5'- CCTATAGATGGGATGGCTGTGCAC -3'
(R):5'- GTAATATGTAAAACATCGTGACACCC -3'
Posted On 2019-12-04