Incidental Mutation 'RF061:Il2'
ID 605402
Institutional Source Beutler Lab
Gene Symbol Il2
Ensembl Gene ENSMUSG00000027720
Gene Name interleukin 2
Synonyms IL-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF061 (G1)
Quality Score 214.458
Status Not validated
Chromosome 3
Chromosomal Location 37120523-37125959 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) GGG to GGGGCTTGAAGTGGG at 37125841 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029275]
AlphaFold P04351
Predicted Effect probably benign
Transcript: ENSMUST00000029275
SMART Domains Protein: ENSMUSP00000029275
Gene: ENSMUSG00000027720

DomainStartEndE-ValueType
IL2 1 168 4.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

DomainStartEndE-ValueType
Pfam:A_deamin 1 176 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants develop adult onset autoimmune disease, with 50% mortality by 9 weeks due to hemolytic anemia. Survivors develop inflammatory bowl disease/colitis. Immune system dysregulation and CD4+ T-cell overproduction may be responsible. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik ACTT ACTTACTT 8: 124,839,831 probably null Het
Abi3bp GCCCACGACCC GCCCACGACCCACGACCC 16: 56,627,587 probably null Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,560,921 probably benign Het
Ankrd24 GAGGC GAGGCGGAGGCATAGGC 10: 81,643,567 probably null Het
Bpifb4 A ACCTCCAC 2: 153,957,128 probably benign Het
Chga CAG CAGAAG 12: 102,561,413 probably benign Het
Chga G GCAC 12: 102,561,427 probably benign Het
Cyb5r4 ACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGA 9: 87,040,435 probably benign Het
Dnmt1 CAGTTCCTACCTCGTT CAGTTCCTACCTCGTTTTGGGGGCGGAGCAAAGTTCCTACCTCGTT 9: 20,910,130 probably null Het
Fbrsl1 GTGCTGGTGCGT GTGCTGGTGCGTCTGCTGGTGCGT 5: 110,378,131 probably benign Het
Gabre GCTCCG GCTCCGACTCCG X: 72,270,048 probably benign Het
Hsdl2 AG AGCAGCAGCCACAGCTGCTG 4: 59,610,657 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGACACCACAGC 1: 83,042,281 probably benign Het
Lrch1 GCTGGTGGT G 14: 74,947,555 probably null Het
Lrch1 GGTGGTGTTG GG 14: 74,947,567 probably null Het
Mamld1 AGC AGCCGC X: 71,118,850 probably benign Het
Map1a TGGCTCCAGCTCCAGCTCCAGCTCCAGCTCC TGGCTCCAGCTCCAGCTCCAGCTCCAGCTCCGGCTCCAGCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Olfr964-ps1 GA GATATA 9: 39,686,753 probably null Het
Pdcd11 AGGAGGAGG AG 19: 47,113,445 probably null Het
Pknox2 ACACACACACACACACTCAC ACAC 9: 36,909,609 probably benign Het
Rfx5 A T 3: 94,955,759 K54I probably damaging Het
Rps19 AAAAAAT AAAAAATAAAAAT 7: 24,889,180 probably benign Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Sbp GACAACA GACAACACAGATGCTAACAACA 17: 23,945,377 probably benign Het
Stab2 CTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 10: 86,866,758 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,092 probably benign Het
Trim33 GGCCCCCGC GGC 3: 103,280,217 probably benign Het
Zfp598 ACAACCAC ACAACCACAACCAC 17: 24,680,770 probably benign Het
Other mutations in Il2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Il2 APN 3 37123007 missense possibly damaging 0.64
IGL02047:Il2 APN 3 37125851 missense probably benign 0.01
FR4304:Il2 UTSW 3 37125826 unclassified probably benign
FR4737:Il2 UTSW 3 37125764 unclassified probably benign
FR4737:Il2 UTSW 3 37125828 unclassified probably benign
FR4976:Il2 UTSW 3 37125829 unclassified probably benign
R8805:Il2 UTSW 3 37123133 missense possibly damaging 0.78
R9287:Il2 UTSW 3 37125839 missense probably damaging 0.99
RF001:Il2 UTSW 3 37125762 unclassified probably benign
RF023:Il2 UTSW 3 37125820 unclassified probably benign
RF029:Il2 UTSW 3 37125827 unclassified probably benign
RF030:Il2 UTSW 3 37125827 unclassified probably benign
RF030:Il2 UTSW 3 37125842 unclassified probably benign
RF033:Il2 UTSW 3 37125764 unclassified probably benign
RF033:Il2 UTSW 3 37125842 unclassified probably benign
RF036:Il2 UTSW 3 37125827 unclassified probably benign
RF038:Il2 UTSW 3 37125821 nonsense probably null
RF039:Il2 UTSW 3 37125842 unclassified probably benign
RF041:Il2 UTSW 3 37125842 unclassified probably benign
RF043:Il2 UTSW 3 37125842 unclassified probably benign
RF051:Il2 UTSW 3 37125841 unclassified probably benign
RF058:Il2 UTSW 3 37125817 unclassified probably benign
RF058:Il2 UTSW 3 37125821 unclassified probably benign
RF064:Il2 UTSW 3 37125764 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGGCAAGAAAGCTAAAGGTATTGC -3'
(R):5'- GCCACACAGGTAGACTCTTTG -3'

Sequencing Primer
(F):5'- CCTATAGATGGGATGGCTGTGCAC -3'
(R):5'- GTAATATGTAAAACATCGTGACACCC -3'
Posted On 2019-12-04