Incidental Mutation 'RF061:Chga'
ID605417
Institutional Source Beutler Lab
Gene Symbol Chga
Ensembl Gene ENSMUSG00000021194
Gene Namechromogranin A
SynonymsChrA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #RF061 (G1)
Quality Score217.468
Status Not validated
Chromosome12
Chromosomal Location102554969-102565028 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) G to GCAC at 102561427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021610]
Predicted Effect probably benign
Transcript: ENSMUST00000021610
SMART Domains Protein: ENSMUSP00000021610
Gene: ENSMUSG00000021194

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Granin 25 95 3e-26 PFAM
Pfam:Granin 87 463 1.7e-95 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the granin family of acidic secretory glycoproteins that are expressed in endocrine cells and neurons. The encoded preproprotein undergoes proteolytic processing to generate multiple functions peptides including pancreastatin, catestatin and serpinin. The encoded protein plays important roles in the neuroendocrine system including regulated secretion of peptide hormones and neurotransmitters. Mice lacking the encoded protein exhibit elevated blood pressure which can be rescued by transgenic expression of the human ortholog. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes and heterozygotes for one allele display hypertension, abnormal plasma and adrenal adrenaline and noradrenaline levels and, in homozygotes, partial embryonic lethality. Homozygotes for a second allele only have elevated urinary adrenaline, noradrenaline and dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik ACTT ACTTACTT 8: 124,839,831 probably null Het
Abi3bp GCCCACGACCC GCCCACGACCCACGACCC 16: 56,627,587 probably null Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,560,921 probably benign Het
Ankrd24 GAGGC GAGGCGGAGGCATAGGC 10: 81,643,567 probably null Het
Bpifb4 A ACCTCCAC 2: 153,957,128 probably benign Het
Cyb5r4 ACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGA 9: 87,040,435 probably benign Het
Dnmt1 CAGTTCCTACCTCGTT CAGTTCCTACCTCGTTTTGGGGGCGGAGCAAAGTTCCTACCTCGTT 9: 20,910,130 probably null Het
Fbrsl1 GTGCTGGTGCGT GTGCTGGTGCGTCTGCTGGTGCGT 5: 110,378,131 probably benign Het
Gabre GCTCCG GCTCCGACTCCG X: 72,270,048 probably benign Het
Hsdl2 AG AGCAGCAGCCACAGCTGCTG 4: 59,610,657 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGACACCACAGC 1: 83,042,281 probably benign Het
Lrch1 GCTGGTGGT G 14: 74,947,555 probably null Het
Lrch1 GGTGGTGTTG GG 14: 74,947,567 probably null Het
Mamld1 AGC AGCCGC X: 71,118,850 probably benign Het
Map1a TGGCTCCAGCTCCAGCTCCAGCTCCAGCTCC TGGCTCCAGCTCCAGCTCCAGCTCCAGCTCCGGCTCCAGCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Olfr964-ps1 GA GATATA 9: 39,686,753 probably null Het
Pdcd11 AGGAGGAGG AG 19: 47,113,445 probably null Het
Pknox2 ACACACACACACACACTCAC ACAC 9: 36,909,609 probably benign Het
Rfx5 A T 3: 94,955,759 K54I probably damaging Het
Rps19 AAAAAAT AAAAAATAAAAAT 7: 24,889,180 probably benign Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Sbp GACAACA GACAACACAGATGCTAACAACA 17: 23,945,377 probably benign Het
Stab2 CTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 10: 86,866,758 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,092 probably benign Het
Trim33 GGCCCCCGC GGC 3: 103,280,217 probably benign Het
Zfp598 ACAACCAC ACAACCACAACCAC 17: 24,680,770 probably benign Het
Other mutations in Chga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chga APN 12 102562799 missense probably damaging 0.98
IGL02674:Chga APN 12 102562901 missense probably damaging 1.00
FR4589:Chga UTSW 12 102561402 small insertion probably benign
R0018:Chga UTSW 12 102558505 missense probably damaging 0.97
R0463:Chga UTSW 12 102562951 nonsense probably null
R1164:Chga UTSW 12 102563045 missense probably damaging 1.00
R1603:Chga UTSW 12 102564607 splice site probably null
R1727:Chga UTSW 12 102561437 missense possibly damaging 0.85
R1778:Chga UTSW 12 102561700 missense probably benign
R1800:Chga UTSW 12 102555905 missense probably damaging 0.99
R2071:Chga UTSW 12 102562863 missense probably damaging 1.00
R3415:Chga UTSW 12 102562784 missense probably benign 0.00
R3696:Chga UTSW 12 102561465 missense probably damaging 0.98
R5022:Chga UTSW 12 102562837 missense probably damaging 1.00
R5507:Chga UTSW 12 102562609 missense probably benign 0.39
R5959:Chga UTSW 12 102561855 missense probably benign
R7338:Chga UTSW 12 102562841 missense probably damaging 1.00
R7410:Chga UTSW 12 102562607 missense probably benign 0.00
R7694:Chga UTSW 12 102561347 missense probably benign 0.05
R8084:Chga UTSW 12 102562069 missense probably benign 0.29
R8211:Chga UTSW 12 102561419 missense possibly damaging 0.71
RF001:Chga UTSW 12 102561423 small insertion probably benign
RF002:Chga UTSW 12 102561421 small insertion probably benign
RF006:Chga UTSW 12 102561412 small insertion probably benign
RF009:Chga UTSW 12 102561420 small insertion probably benign
RF010:Chga UTSW 12 102561403 small insertion probably benign
RF014:Chga UTSW 12 102561393 small insertion probably benign
RF014:Chga UTSW 12 102561405 small insertion probably benign
RF015:Chga UTSW 12 102561420 small insertion probably benign
RF022:Chga UTSW 12 102561420 small insertion probably benign
RF033:Chga UTSW 12 102561396 small insertion probably benign
RF035:Chga UTSW 12 102561427 small insertion probably benign
RF044:Chga UTSW 12 102561396 small insertion probably benign
RF048:Chga UTSW 12 102561403 small insertion probably benign
RF048:Chga UTSW 12 102561421 small insertion probably benign
RF049:Chga UTSW 12 102561393 small insertion probably benign
RF052:Chga UTSW 12 102561416 small insertion probably benign
RF054:Chga UTSW 12 102561423 small insertion probably benign
RF056:Chga UTSW 12 102561424 small insertion probably benign
RF058:Chga UTSW 12 102561416 small insertion probably benign
RF060:Chga UTSW 12 102561424 small insertion probably benign
RF061:Chga UTSW 12 102561413 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGAGAGCCTGTACCCTCAAG -3'
(R):5'- CTGCAAACACAAATGGATAGGGTC -3'

Sequencing Primer
(F):5'- CTCAAGGGAGGCCTTCAGTGTTAC -3'
(R):5'- TCCTGAGGCCAAGTTCAATG -3'
Posted On2019-12-04