Incidental Mutation 'RF061:Abi3bp'
ID 605420
Institutional Source Beutler Lab
Gene Symbol Abi3bp
Ensembl Gene ENSMUSG00000035258
Gene Name ABI gene family, member 3 (NESH) binding protein
Synonyms D930038M13Rik, eratin, TARSH, 5033411B22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # RF061 (G1)
Quality Score 217.468
Status Not validated
Chromosome 16
Chromosomal Location 56477878-56690135 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) GCCCACGACCC to GCCCACGACCCACGACCC at 56627587 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048471] [ENSMUST00000096012] [ENSMUST00000096013] [ENSMUST00000171000] [ENSMUST00000231781] [ENSMUST00000231832] [ENSMUST00000231870]
AlphaFold A0A338P6S8
Predicted Effect probably benign
Transcript: ENSMUST00000048471
SMART Domains Protein: ENSMUSP00000036257
Gene: ENSMUSG00000035258

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 579 591 N/A INTRINSIC
low complexity region 734 747 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
FN3 941 1024 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096012
SMART Domains Protein: ENSMUSP00000093711
Gene: ENSMUSG00000035258

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 651 664 N/A INTRINSIC
FN3 841 924 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096013
SMART Domains Protein: ENSMUSP00000093712
Gene: ENSMUSG00000035258

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
FN3 877 960 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171000
SMART Domains Protein: ENSMUSP00000128818
Gene: ENSMUSG00000035258

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 464 477 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
FN3 671 754 6.29e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000231781
Predicted Effect probably benign
Transcript: ENSMUST00000231832
Predicted Effect probably benign
Transcript: ENSMUST00000231870
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik ACTT ACTTACTT 8: 124,839,831 probably null Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,560,921 probably benign Het
Ankrd24 GAGGC GAGGCGGAGGCATAGGC 10: 81,643,567 probably null Het
Bpifb4 A ACCTCCAC 2: 153,957,128 probably benign Het
Chga CAG CAGAAG 12: 102,561,413 probably benign Het
Chga G GCAC 12: 102,561,427 probably benign Het
Cyb5r4 ACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGA 9: 87,040,435 probably benign Het
Dnmt1 CAGTTCCTACCTCGTT CAGTTCCTACCTCGTTTTGGGGGCGGAGCAAAGTTCCTACCTCGTT 9: 20,910,130 probably null Het
Fbrsl1 GTGCTGGTGCGT GTGCTGGTGCGTCTGCTGGTGCGT 5: 110,378,131 probably benign Het
Gabre GCTCCG GCTCCGACTCCG X: 72,270,048 probably benign Het
Hsdl2 AG AGCAGCAGCCACAGCTGCTG 4: 59,610,657 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGACACCACAGC 1: 83,042,281 probably benign Het
Lrch1 GCTGGTGGT G 14: 74,947,555 probably null Het
Lrch1 GGTGGTGTTG GG 14: 74,947,567 probably null Het
Mamld1 AGC AGCCGC X: 71,118,850 probably benign Het
Map1a TGGCTCCAGCTCCAGCTCCAGCTCCAGCTCC TGGCTCCAGCTCCAGCTCCAGCTCCAGCTCCGGCTCCAGCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Olfr964-ps1 GA GATATA 9: 39,686,753 probably null Het
Pdcd11 AGGAGGAGG AG 19: 47,113,445 probably null Het
Pknox2 ACACACACACACACACTCAC ACAC 9: 36,909,609 probably benign Het
Rfx5 A T 3: 94,955,759 K54I probably damaging Het
Rps19 AAAAAAT AAAAAATAAAAAT 7: 24,889,180 probably benign Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Sbp GACAACA GACAACACAGATGCTAACAACA 17: 23,945,377 probably benign Het
Stab2 CTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 10: 86,866,758 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,092 probably benign Het
Trim33 GGCCCCCGC GGC 3: 103,280,217 probably benign Het
Zfp598 ACAACCAC ACAACCACAACCAC 17: 24,680,770 probably benign Het
Other mutations in Abi3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Abi3bp APN 16 56602805 missense probably null 0.99
IGL01580:Abi3bp APN 16 56675210 missense probably damaging 1.00
IGL01633:Abi3bp APN 16 56677800 missense probably damaging 1.00
IGL01783:Abi3bp APN 16 56532969 critical splice donor site probably null
IGL01866:Abi3bp APN 16 56671973 missense probably benign 0.19
IGL02022:Abi3bp APN 16 56592636 missense probably damaging 1.00
IGL02086:Abi3bp APN 16 56642567 splice site probably benign
IGL02122:Abi3bp APN 16 56687128 splice site probably benign
IGL02155:Abi3bp APN 16 56587964 missense probably damaging 0.99
IGL02351:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02358:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02418:Abi3bp APN 16 56604116 splice site probably benign
IGL02559:Abi3bp APN 16 56687070 nonsense probably null
IGL02617:Abi3bp APN 16 56574444 nonsense probably null
IGL02810:Abi3bp APN 16 56677775 missense probably damaging 1.00
IGL03057:Abi3bp APN 16 56668391 missense possibly damaging 0.95
IGL03174:Abi3bp APN 16 56614747 missense possibly damaging 0.64
R0389:Abi3bp UTSW 16 56671307 missense possibly damaging 0.79
R0485:Abi3bp UTSW 16 56604012 splice site probably null
R0557:Abi3bp UTSW 16 56668387 missense probably damaging 0.97
R0616:Abi3bp UTSW 16 56654070 missense probably damaging 0.99
R0685:Abi3bp UTSW 16 56532953 missense possibly damaging 0.90
R0783:Abi3bp UTSW 16 56595238 critical splice acceptor site probably null
R0828:Abi3bp UTSW 16 56677830 missense probably damaging 1.00
R0841:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1078:Abi3bp UTSW 16 56654081 critical splice donor site probably null
R1101:Abi3bp UTSW 16 56606158 missense probably damaging 1.00
R1116:Abi3bp UTSW 16 56686429 splice site probably benign
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1317:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1384:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1460:Abi3bp UTSW 16 56562417 missense probably damaging 0.99
R1730:Abi3bp UTSW 16 56668279 missense possibly damaging 0.62
R1761:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1830:Abi3bp UTSW 16 56587985 missense probably damaging 1.00
R1873:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1875:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1996:Abi3bp UTSW 16 56671357 missense possibly damaging 0.61
R2018:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2019:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2035:Abi3bp UTSW 16 56660218 missense probably benign 0.21
R2118:Abi3bp UTSW 16 56477864 unclassified probably benign
R2202:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R2202:Abi3bp UTSW 16 56650725 nonsense probably null
R2203:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R3030:Abi3bp UTSW 16 56657319 missense possibly damaging 0.79
R3952:Abi3bp UTSW 16 56604038 missense possibly damaging 0.88
R4176:Abi3bp UTSW 16 56652200 missense probably damaging 0.96
R4296:Abi3bp UTSW 16 56668310 missense probably benign 0.05
R4301:Abi3bp UTSW 16 56556903 missense probably damaging 1.00
R4354:Abi3bp UTSW 16 56532951 missense probably benign 0.05
R4417:Abi3bp UTSW 16 56654035 missense probably damaging 1.00
R4716:Abi3bp UTSW 16 56650725 nonsense probably null
R4808:Abi3bp UTSW 16 56594516 missense probably damaging 0.96
R4814:Abi3bp UTSW 16 56650753 missense probably benign 0.06
R5016:Abi3bp UTSW 16 56671268 missense probably damaging 0.97
R5290:Abi3bp UTSW 16 56642475 splice site probably null
R5891:Abi3bp UTSW 16 56606133 missense probably damaging 1.00
R5897:Abi3bp UTSW 16 56604669 missense possibly damaging 0.53
R6146:Abi3bp UTSW 16 56671265 missense probably damaging 0.99
R6267:Abi3bp UTSW 16 56594497 missense probably damaging 0.97
R6905:Abi3bp UTSW 16 56574517 missense probably damaging 1.00
R6908:Abi3bp UTSW 16 56657305 missense probably benign 0.01
R6917:Abi3bp UTSW 16 56617321 splice site probably null
R7071:Abi3bp UTSW 16 56629140 nonsense probably null
R7194:Abi3bp UTSW 16 56562371 missense probably damaging 0.99
R7476:Abi3bp UTSW 16 56614746 nonsense probably null
R7554:Abi3bp UTSW 16 56618212 splice site probably null
R7571:Abi3bp UTSW 16 56630982 splice site probably null
R7661:Abi3bp UTSW 16 56632900 splice site probably null
R7662:Abi3bp UTSW 16 56617323 splice site probably null
R7910:Abi3bp UTSW 16 56677742 nonsense probably null
R8121:Abi3bp UTSW 16 56631878 missense unknown
R8781:Abi3bp UTSW 16 56606149 missense probably damaging 0.98
R8790:Abi3bp UTSW 16 56675074 missense probably damaging 1.00
R8828:Abi3bp UTSW 16 56687092 missense probably damaging 1.00
R9094:Abi3bp UTSW 16 56636227 missense probably benign 0.00
R9135:Abi3bp UTSW 16 56596810 missense probably benign 0.21
R9282:Abi3bp UTSW 16 56620504 missense unknown
R9363:Abi3bp UTSW 16 56618212 splice site probably null
R9464:Abi3bp UTSW 16 56588683 missense possibly damaging 0.48
R9506:Abi3bp UTSW 16 56617410 missense unknown
RF008:Abi3bp UTSW 16 56627589 intron probably benign
RF016:Abi3bp UTSW 16 56627587 frame shift probably null
RF052:Abi3bp UTSW 16 56627585 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTCTAGCATTGAACGAGCAACTC -3'
(R):5'- CTGTTTACCACAAGCACTGC -3'

Sequencing Primer
(F):5'- GCAACTCAACAACAGGATTTTACTTC -3'
(R):5'- CACTGCTTTGAGCCTCTGATGG -3'
Posted On 2019-12-04