Incidental Mutation 'RF061:Zfp598'
ID605422
Institutional Source Beutler Lab
Gene Symbol Zfp598
Ensembl Gene ENSMUSG00000041130
Gene Namezinc finger protein 598
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #RF061 (G1)
Quality Score214.458
Status Not validated
Chromosome17
Chromosomal Location24669752-24682015 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) ACAACCAC to ACAACCACAACCAC at 24680770 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007236] [ENSMUST00000047179]
Predicted Effect probably benign
Transcript: ENSMUST00000007236
SMART Domains Protein: ENSMUSP00000007236
Gene: ENSMUSG00000007021

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:MARVEL 20 166 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047179
SMART Domains Protein: ENSMUSP00000038367
Gene: ENSMUSG00000041130

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
RING 27 66 4.73e-1 SMART
ZnF_C2H2 115 140 9.46e0 SMART
low complexity region 144 153 N/A INTRINSIC
ZnF_C2H2 185 208 5.2e0 SMART
ZnF_C2H2 209 237 7.11e0 SMART
ZnF_C2H2 238 268 6.47e1 SMART
low complexity region 311 331 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 526 544 N/A INTRINSIC
low complexity region 581 589 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 668 683 N/A INTRINSIC
low complexity region 694 748 N/A INTRINSIC
ZnF_C2H2 869 890 8.84e1 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This protein and Grb10-interacting GYF protein 2 have been identified as a components of the mammalian 4EHP (m4EHP) complex. The complex is thought to function as a translation repressor in embryonic development. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik ACTT ACTTACTT 8: 124,839,831 probably null Het
Abi3bp GCCCACGACCC GCCCACGACCCACGACCC 16: 56,627,587 probably null Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,560,921 probably benign Het
Ankrd24 GAGGC GAGGCGGAGGCATAGGC 10: 81,643,567 probably null Het
Bpifb4 A ACCTCCAC 2: 153,957,128 probably benign Het
Chga CAG CAGAAG 12: 102,561,413 probably benign Het
Chga G GCAC 12: 102,561,427 probably benign Het
Cyb5r4 ACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGA 9: 87,040,435 probably benign Het
Dnmt1 CAGTTCCTACCTCGTT CAGTTCCTACCTCGTTTTGGGGGCGGAGCAAAGTTCCTACCTCGTT 9: 20,910,130 probably null Het
Fbrsl1 GTGCTGGTGCGT GTGCTGGTGCGTCTGCTGGTGCGT 5: 110,378,131 probably benign Het
Gabre GCTCCG GCTCCGACTCCG X: 72,270,048 probably benign Het
Hsdl2 AG AGCAGCAGCCACAGCTGCTG 4: 59,610,657 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGACACCACAGC 1: 83,042,281 probably benign Het
Lrch1 GCTGGTGGT G 14: 74,947,555 probably null Het
Lrch1 GGTGGTGTTG GG 14: 74,947,567 probably null Het
Mamld1 AGC AGCCGC X: 71,118,850 probably benign Het
Map1a TGGCTCCAGCTCCAGCTCCAGCTCCAGCTCC TGGCTCCAGCTCCAGCTCCAGCTCCAGCTCCGGCTCCAGCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Olfr964-ps1 GA GATATA 9: 39,686,753 probably null Het
Pdcd11 AGGAGGAGG AG 19: 47,113,445 probably null Het
Pknox2 ACACACACACACACACTCAC ACAC 9: 36,909,609 probably benign Het
Rfx5 A T 3: 94,955,759 K54I probably damaging Het
Rps19 AAAAAAT AAAAAATAAAAAT 7: 24,889,180 probably benign Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Sbp GACAACA GACAACACAGATGCTAACAACA 17: 23,945,377 probably benign Het
Stab2 CTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 10: 86,866,758 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,092 probably benign Het
Trim33 GGCCCCCGC GGC 3: 103,280,217 probably benign Het
Other mutations in Zfp598
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Zfp598 APN 17 24681424 unclassified probably benign
IGL02118:Zfp598 APN 17 24677617 missense probably damaging 1.00
IGL02178:Zfp598 APN 17 24677543 missense probably damaging 1.00
IGL02591:Zfp598 APN 17 24677504 missense probably damaging 1.00
IGL03061:Zfp598 APN 17 24679592 missense probably benign 0.03
FR4304:Zfp598 UTSW 17 24680775 small insertion probably benign
FR4340:Zfp598 UTSW 17 24679372 small deletion probably benign
FR4340:Zfp598 UTSW 17 24680783 small insertion probably benign
FR4342:Zfp598 UTSW 17 24680780 small insertion probably benign
FR4449:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4449:Zfp598 UTSW 17 24680785 small insertion probably benign
FR4548:Zfp598 UTSW 17 24680775 small insertion probably benign
FR4548:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4589:Zfp598 UTSW 17 24680779 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680782 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680791 small insertion probably benign
FR4976:Zfp598 UTSW 17 24679372 small deletion probably benign
FR4976:Zfp598 UTSW 17 24680782 small insertion probably benign
R0309:Zfp598 UTSW 17 24678584 splice site probably benign
R1295:Zfp598 UTSW 17 24679649 missense probably benign 0.00
R1296:Zfp598 UTSW 17 24679649 missense probably benign 0.00
R1471:Zfp598 UTSW 17 24680072 missense probably benign 0.00
R1523:Zfp598 UTSW 17 24678629 missense probably null 1.00
R1819:Zfp598 UTSW 17 24681130 unclassified probably benign
R2001:Zfp598 UTSW 17 24669924 missense possibly damaging 0.94
R2080:Zfp598 UTSW 17 24679667 missense probably damaging 1.00
R4447:Zfp598 UTSW 17 24676555 missense probably damaging 1.00
R5086:Zfp598 UTSW 17 24680898 unclassified probably benign
R5923:Zfp598 UTSW 17 24677549 missense probably damaging 1.00
R6191:Zfp598 UTSW 17 24677876 missense possibly damaging 0.89
R6680:Zfp598 UTSW 17 24678686 missense probably benign 0.06
R7438:Zfp598 UTSW 17 24677530 missense probably damaging 1.00
R7870:Zfp598 UTSW 17 24679330 missense probably damaging 0.98
RF009:Zfp598 UTSW 17 24680787 small insertion probably benign
RF016:Zfp598 UTSW 17 24680771 small insertion probably benign
RF018:Zfp598 UTSW 17 24680771 small insertion probably benign
RF053:Zfp598 UTSW 17 24680761 small insertion probably benign
RF058:Zfp598 UTSW 17 24680761 small insertion probably benign
RF064:Zfp598 UTSW 17 24680783 small insertion probably benign
Z1088:Zfp598 UTSW 17 24680210 small insertion probably benign
Z1177:Zfp598 UTSW 17 24679639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGGGCTAGTTGGGATCAC -3'
(R):5'- TGCAGAAAGTCCTTGATAGACTGG -3'

Sequencing Primer
(F):5'- TTGGGATCACACTGAAGCTC -3'
(R):5'- CCTTGATAGACTGGATAAGCTGC -3'
Posted On2019-12-04