Incidental Mutation 'R0114:Ino80'
ID60543
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene NameINO80 complex subunit
SynonymsINO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission 038400-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R0114 (G1)
Quality Score221
Status Validated
Chromosome2
Chromosomal Location119373042-119477687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119382960 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1249 (R1249C)
Ref Sequence ENSEMBL: ENSMUSP00000051845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920]
Predicted Effect probably damaging
Transcript: ENSMUST00000049920
AA Change: R1249C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: R1249C

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 79.2%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,985,982 probably benign Het
4933427D14Rik T C 11: 72,195,799 Y262C probably damaging Het
Adamts1 C A 16: 85,799,614 V379L probably benign Het
Akt3 T C 1: 177,067,251 D260G probably damaging Het
Alms1 T C 6: 85,619,803 L537P probably benign Het
Anln A T 9: 22,353,346 I876N probably damaging Het
Ano9 A T 7: 141,103,239 probably benign Het
Arhgef10l T C 4: 140,583,883 E218G probably benign Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Atp9a G T 2: 168,710,856 Y63* probably null Het
Bmpr2 G T 1: 59,815,340 C116F probably damaging Het
Cand1 T C 10: 119,216,522 D233G probably benign Het
Cftr A T 6: 18,282,448 H1049L probably damaging Het
Ckap5 A T 2: 91,620,112 D1975V possibly damaging Het
Cyp26c1 T C 19: 37,686,633 V134A probably benign Het
Dnaic1 T C 4: 41,605,686 probably benign Het
Dpp10 T C 1: 123,486,092 I163V probably benign Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Fanca A T 8: 123,288,491 probably null Het
Fes A G 7: 80,378,035 V787A probably damaging Het
Fnip1 C T 11: 54,487,801 probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gm1840 A G 8: 5,640,359 noncoding transcript Het
Gmds A T 13: 32,227,281 S57T probably benign Het
Gnpat T G 8: 124,883,357 D426E probably benign Het
Gnptab C A 10: 88,433,400 P655Q possibly damaging Het
Herc1 T A 9: 66,461,846 F2941I probably damaging Het
Herc2 T C 7: 56,153,774 probably benign Het
Itga11 T G 9: 62,735,293 V166G probably damaging Het
Itga11 T C 9: 62,760,302 V639A possibly damaging Het
Itpr2 A G 6: 146,312,879 F1490S probably damaging Het
Lama2 C A 10: 26,993,068 E802* probably null Het
Lgi3 C T 14: 70,531,029 probably benign Het
Limch1 C T 5: 67,036,084 probably benign Het
Lipc T C 9: 70,803,781 N363S probably damaging Het
Lrit2 A G 14: 37,068,045 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mug2 A G 6: 122,040,648 Y448C probably damaging Het
Mybpc3 A G 2: 91,124,494 E450G probably damaging Het
Myo5b A T 18: 74,742,171 T1549S probably benign Het
Naa15 T C 3: 51,448,438 probably null Het
Nckap1l T A 15: 103,455,028 C54S probably benign Het
Nlrp9b A G 7: 20,024,056 D406G probably benign Het
Nprl3 T A 11: 32,239,784 probably benign Het
Nvl A G 1: 181,120,391 V429A probably benign Het
Olfr114 A T 17: 37,589,415 *313K probably null Het
Olfr54 G A 11: 51,027,604 V201I probably benign Het
Olfr548-ps1 A T 7: 102,542,731 Q265L probably benign Het
Olfr801 T A 10: 129,669,598 Y307F probably benign Het
Opa1 A T 16: 29,629,635 N912Y probably benign Het
Pcnx T C 12: 81,996,095 V2317A possibly damaging Het
Phf3 A T 1: 30,805,443 N1478K possibly damaging Het
Phykpl G A 11: 51,586,653 D91N probably benign Het
Polr2b T A 5: 77,343,263 C984S probably damaging Het
Ppfibp1 A G 6: 146,998,233 R141G probably benign Het
Ppm1d G A 11: 85,326,905 G20R probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppp2r5b C A 19: 6,228,431 V483F probably benign Het
Ppp4r4 T A 12: 103,576,374 C132S probably benign Het
Prg2 A G 2: 84,983,456 probably benign Het
Prpf4b G A 13: 34,890,488 probably benign Het
Rad54l2 T C 9: 106,713,455 T491A probably damaging Het
Rnf213 G T 11: 119,414,587 W548L probably damaging Het
Rusc2 G T 4: 43,422,055 C825F probably damaging Het
Sema4b A G 7: 80,219,078 probably benign Het
Sema6a A G 18: 47,290,177 V254A probably damaging Het
Slc13a3 A G 2: 165,424,581 F346L probably damaging Het
Slc25a17 T C 15: 81,337,959 D104G probably damaging Het
Specc1 A T 11: 62,146,313 N707Y possibly damaging Het
Tex48 T A 4: 63,608,459 E76V probably damaging Het
Tfr2 T C 5: 137,577,465 V281A probably benign Het
Tgfb1i1 A C 7: 128,249,494 Q238H probably damaging Het
Thoc6 G A 17: 23,670,239 T122I probably benign Het
Tmtc1 G A 6: 148,412,830 probably benign Het
Tnfrsf8 T C 4: 145,288,047 D264G possibly damaging Het
Trim43a T A 9: 88,584,160 I178N probably damaging Het
Ttn G C 2: 76,707,093 I26503M possibly damaging Het
Usp28 C A 9: 49,039,023 D589E probably benign Het
Utp23 T C 15: 51,882,511 S242P probably damaging Het
Vwa3a A G 7: 120,775,380 Y305C probably benign Het
Vwa5b1 C A 4: 138,608,858 E142* probably null Het
Xrn2 A T 2: 147,029,779 T374S probably damaging Het
Zfp735 A T 11: 73,710,662 Q144L probably benign Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
R7702:Ino80 UTSW 2 119442573 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTCACAGGAACTCAGGGTAAATCTGAA -3'
(R):5'- ACACTGATACCAGGAAGGGTGACAT -3'

Sequencing Primer
(F):5'- cacacacacacacacactc -3'
(R):5'- GACATTTCAGAGTTCACCTTGG -3'
Posted On2013-07-24