Incidental Mutation 'RF062:Gm11060'
ID605430
Institutional Source Beutler Lab
Gene Symbol Gm11060
Ensembl Gene ENSMUSG00000079175
Gene Namepredicted gene 11060
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #RF062 (G1)
Quality Score110.592
Status Not validated
Chromosome2
Chromosomal Location105092018-105093760 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTGTGTG to CTG at 105092040 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106736 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000111107
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 GTGGCGGCGGCGGC G 2: 25,272,537 probably null Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,918 probably benign Het
Cckbr CAG C 7: 105,434,687 probably null Het
Defb22 TGGCCT TGGCCTCTGCGGCAGAGCCGGCCT 2: 152,485,825 probably benign Het
Dmkn GGTGGAAGTGGTGGAAGTGGTGGAAGT GGTGGAAGTGGTGGAAGTGGTGGAAGTCGTGGAAGTGGTGGAAGTGGTGGAAGT 7: 30,767,175 probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,755 probably benign Het
Efhd2 CC CCGCCGAC 4: 141,874,774 probably benign Het
Fsip2 TTTT TTTTGTTT 2: 82,984,363 probably benign Het
Gm5591 GC G 7: 38,522,335 probably null Het
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 ACCACCGCC ACCACCGCCACCGCC 11: 99,389,264 probably benign Het
Nefh TGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGGGACTTGGCCTCACCGGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,028 probably benign Het
Nusap1 CAAGCTGAGA CAAGCTGAGATACACGTTAGCAGTGAGGAGGAAGCTGAGA 2: 119,627,601 probably benign Het
Nusap1 A ATACACGTTAGCAGTGAGGAGCAAGCTGAGG 2: 119,627,610 probably benign Het
Rfx4 CTCTCTCTCTCTCT CTCTCTCTCTCTCTCTATCTCTCTCTCTCT 10: 84,858,481 probably benign Het
St5 GGGCAGCCCTCACTGA G 7: 109,556,946 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tnfaip8 ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,831 probably benign Het
Zfp384 CCCAGGCCCAGGCCCAGGCCCAGG CCCAGGCCCAGGACCAGGCCCAGGCCCAGGCCCAGG 6: 125,036,466 probably benign Het
Other mutations in Gm11060
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1454:Gm11060 UTSW 2 105093752 missense unknown
R4974:Gm11060 UTSW 2 105093783 unclassified probably benign
RF031:Gm11060 UTSW 2 105092040 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGCCTGGCTTCTGAAATGC -3'
(R):5'- GAAGGTGTCCAATCTCTGGTTC -3'

Sequencing Primer
(F):5'- TAATGGCGTGCATACTCTAAGATGC -3'
(R):5'- AAGGTGTCCAATCTCTGGTTCTTCTC -3'
Posted On2019-12-04