Incidental Mutation 'RF062:Gm5591'
ID605438
Institutional Source Beutler Lab
Gene Symbol Gm5591
Ensembl Gene ENSMUSG00000060565
Gene Namepredicted gene 5591
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #RF062 (G1)
Quality Score143.512
Status Not validated
Chromosome7
Chromosomal Location38518139-38528193 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GC to G at 38522335 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079759]
Predicted Effect probably null
Transcript: ENSMUST00000079759
SMART Domains Protein: ENSMUSP00000078695
Gene: ENSMUSG00000060565

DomainStartEndE-ValueType
low complexity region 319 330 N/A INTRINSIC
Pfam:DUF4629 437 582 1.2e-59 PFAM
low complexity region 648 660 N/A INTRINSIC
low complexity region 693 704 N/A INTRINSIC
low complexity region 711 723 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 GTGGCGGCGGCGGC G 2: 25,272,537 probably null Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,918 probably benign Het
Cckbr CAG C 7: 105,434,687 probably null Het
Defb22 TGGCCT TGGCCTCTGCGGCAGAGCCGGCCT 2: 152,485,825 probably benign Het
Dmkn GGTGGAAGTGGTGGAAGTGGTGGAAGT GGTGGAAGTGGTGGAAGTGGTGGAAGTCGTGGAAGTGGTGGAAGTGGTGGAAGT 7: 30,767,175 probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,755 probably benign Het
Efhd2 CC CCGCCGAC 4: 141,874,774 probably benign Het
Fsip2 TTTT TTTTGTTT 2: 82,984,363 probably benign Het
Gm11060 CTGTGTG CTG 2: 105,092,040 probably null Het
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 ACCACCGCC ACCACCGCCACCGCC 11: 99,389,264 probably benign Het
Nefh TGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGGGACTTGGCCTCACCGGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,028 probably benign Het
Nusap1 CAAGCTGAGA CAAGCTGAGATACACGTTAGCAGTGAGGAGGAAGCTGAGA 2: 119,627,601 probably benign Het
Nusap1 A ATACACGTTAGCAGTGAGGAGCAAGCTGAGG 2: 119,627,610 probably benign Het
Rfx4 CTCTCTCTCTCTCT CTCTCTCTCTCTCTCTATCTCTCTCTCTCT 10: 84,858,481 probably benign Het
St5 GGGCAGCCCTCACTGA G 7: 109,556,946 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tnfaip8 ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,831 probably benign Het
Zfp384 CCCAGGCCCAGGCCCAGGCCCAGG CCCAGGCCCAGGACCAGGCCCAGGCCCAGGCCCAGG 6: 125,036,466 probably benign Het
Other mutations in Gm5591
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm5591 APN 7 38520414 missense probably benign 0.20
IGL02277:Gm5591 APN 7 38520432 missense probably damaging 0.98
IGL02277:Gm5591 APN 7 38519038 missense possibly damaging 0.92
IGL02503:Gm5591 APN 7 38520009 missense probably damaging 1.00
IGL02897:Gm5591 APN 7 38520042 missense probably damaging 1.00
IGL02899:Gm5591 APN 7 38519418 missense probably damaging 1.00
R1599:Gm5591 UTSW 7 38520370 missense probably benign
R2365:Gm5591 UTSW 7 38519401 missense probably damaging 1.00
R3054:Gm5591 UTSW 7 38520634 missense probably benign 0.35
R4619:Gm5591 UTSW 7 38520648 missense probably benign 0.04
R4722:Gm5591 UTSW 7 38519148 missense probably damaging 1.00
R4779:Gm5591 UTSW 7 38522256 missense probably damaging 0.96
R5079:Gm5591 UTSW 7 38522136 missense probably benign 0.01
R5237:Gm5591 UTSW 7 38522207 missense probably benign 0.31
R5267:Gm5591 UTSW 7 38518914 missense possibly damaging 0.94
R6337:Gm5591 UTSW 7 38521895 missense probably benign 0.00
R6458:Gm5591 UTSW 7 38519035 missense probably damaging 1.00
R6671:Gm5591 UTSW 7 38520099 missense possibly damaging 0.71
R6709:Gm5591 UTSW 7 38522075 missense probably benign 0.31
R6874:Gm5591 UTSW 7 38520291 missense probably damaging 0.97
R6917:Gm5591 UTSW 7 38522190 missense probably damaging 0.99
R6993:Gm5591 UTSW 7 38519223 missense probably benign
R7446:Gm5591 UTSW 7 38519509 missense probably benign 0.16
R7519:Gm5591 UTSW 7 38520670 missense possibly damaging 0.70
R7596:Gm5591 UTSW 7 38520184 missense probably benign
R8003:Gm5591 UTSW 7 38519759 missense probably damaging 0.96
R8027:Gm5591 UTSW 7 38522298 missense probably damaging 0.99
R8058:Gm5591 UTSW 7 38518939 missense probably benign 0.00
RF052:Gm5591 UTSW 7 38522575 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTAGTAGTACACCTGGCTGC -3'
(R):5'- GCATGGATCCTACCACCAAG -3'

Sequencing Primer
(F):5'- AAGGTGCCAGGCTGTATCC -3'
(R):5'- GCACCAACACTTCTGTCCAGG -3'
Posted On2019-12-04