Incidental Mutation 'RF062:Cckbr'
ID605439
Institutional Source Beutler Lab
Gene Symbol Cckbr
Ensembl Gene ENSMUSG00000030898
Gene Namecholecystokinin B receptor
SynonymsCCK2/gastrin, CCK2R, CCKR-2, CCK-B/gastrin receptor
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #RF062 (G1)
Quality Score128.457
Status Not validated
Chromosome7
Chromosomal Location105425731-105470898 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAG to C at 105434687 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033189] [ENSMUST00000181339]
Predicted Effect probably null
Transcript: ENSMUST00000033189
SMART Domains Protein: ENSMUSP00000033189
Gene: ENSMUSG00000030898

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:7tm_1 71 396 4.1e-59 PFAM
low complexity region 409 434 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000181339
SMART Domains Protein: ENSMUSP00000138052
Gene: ENSMUSG00000030898

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:7tm_1 71 301 3.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multipass transmembrane receptor protein expressed in the central nervous system and gastrointestinal tract. Cholecystokinin and gastrin bind to the encoded protein to stimulate gastric acid secretion and mucosal growth in the gastrointestinal tract, and anxiety, pain sensation and memory in the brain. Mice lacking the encoded protein exhibit an increase in the basal gastric pH and gastrin levels in the bloodstream as well as mild hypocalcemia, secondary hyperparathyroidism and increased bone resorption. [provided by RefSeq, Apr 2015]
PHENOTYPE: Nullizygous mice show gastic mucoca defects, high gastic pH and hypergastrenemia. Homozygotes for a null allele also exhibit higher energy intake and expenditure, less susceptibility to endotoxin shock, altered pain and mechanical sensitivity, and behavioral changes to isolation and addictive drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 GTGGCGGCGGCGGC G 2: 25,272,537 probably null Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,918 probably benign Het
Defb22 TGGCCT TGGCCTCTGCGGCAGAGCCGGCCT 2: 152,485,825 probably benign Het
Dmkn GGTGGAAGTGGTGGAAGTGGTGGAAGT GGTGGAAGTGGTGGAAGTGGTGGAAGTCGTGGAAGTGGTGGAAGTGGTGGAAGT 7: 30,767,175 probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,755 probably benign Het
Efhd2 CC CCGCCGAC 4: 141,874,774 probably benign Het
Fsip2 TTTT TTTTGTTT 2: 82,984,363 probably benign Het
Gm11060 CTGTGTG CTG 2: 105,092,040 probably null Het
Gm5591 GC G 7: 38,522,335 probably null Het
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 ACCACCGCC ACCACCGCCACCGCC 11: 99,389,264 probably benign Het
Nefh TGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGGGACTTGGCCTCACCGGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,028 probably benign Het
Nusap1 CAAGCTGAGA CAAGCTGAGATACACGTTAGCAGTGAGGAGGAAGCTGAGA 2: 119,627,601 probably benign Het
Nusap1 A ATACACGTTAGCAGTGAGGAGCAAGCTGAGG 2: 119,627,610 probably benign Het
Rfx4 CTCTCTCTCTCTCT CTCTCTCTCTCTCTCTATCTCTCTCTCTCT 10: 84,858,481 probably benign Het
St5 GGGCAGCCCTCACTGA G 7: 109,556,946 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tnfaip8 ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,831 probably benign Het
Zfp384 CCCAGGCCCAGGCCCAGGCCCAGG CCCAGGCCCAGGACCAGGCCCAGGCCCAGGCCCAGG 6: 125,036,466 probably benign Het
Other mutations in Cckbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Cckbr APN 7 105434242 missense probably benign 0.01
IGL01630:Cckbr APN 7 105434086 missense probably damaging 1.00
IGL01931:Cckbr APN 7 105426103 missense probably benign
IGL01955:Cckbr APN 7 105434962 missense probably damaging 0.97
IGL02219:Cckbr APN 7 105434048 missense probably damaging 1.00
IGL02820:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02858:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02878:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02946:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL03179:Cckbr APN 7 105434923 missense probably benign 0.02
FR4548:Cckbr UTSW 7 105434681 small deletion probably benign
R0380:Cckbr UTSW 7 105434991 missense probably benign 0.00
R1767:Cckbr UTSW 7 105434551 missense possibly damaging 0.56
R3890:Cckbr UTSW 7 105426169 missense probably benign 0.00
R3892:Cckbr UTSW 7 105426169 missense probably benign 0.00
R5116:Cckbr UTSW 7 105433655 missense probably damaging 1.00
R5589:Cckbr UTSW 7 105434525 missense probably damaging 0.98
R5975:Cckbr UTSW 7 105470619 missense probably benign 0.07
R6797:Cckbr UTSW 7 105434566 missense possibly damaging 0.85
R6940:Cckbr UTSW 7 105434896 missense probably benign 0.00
R7194:Cckbr UTSW 7 105435345 missense possibly damaging 0.72
R7293:Cckbr UTSW 7 105434645 missense probably benign 0.05
R7581:Cckbr UTSW 7 105433786 missense probably benign 0.05
R7793:Cckbr UTSW 7 105433591 missense probably benign 0.00
R7891:Cckbr UTSW 7 105435350 missense probably benign 0.00
R7974:Cckbr UTSW 7 105435350 missense probably benign 0.00
RF009:Cckbr UTSW 7 105434686 frame shift probably null
RF039:Cckbr UTSW 7 105434686 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTCCGTGCTTCTGCTAATAC -3'
(R):5'- AGCAGCCATCACTGTCTTCC -3'

Sequencing Primer
(F):5'- GTGCTTCTGCTAATACTGCTG -3'
(R):5'- AGTCAGGCTGGTCACATGC -3'
Posted On2019-12-04