Incidental Mutation 'RF062:Krt10'
ID605443
Institutional Source Beutler Lab
Gene Symbol Krt10
Ensembl Gene ENSMUSG00000019761
Gene Namekeratin 10
SynonymsKrt1-10, suprabasal cytokeratin 10, K10, Krt-1.10, keratin 10, D130054E02Rik, cytokeratin 10, K1C1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #RF062 (G1)
Quality Score214.458
Status Not validated
Chromosome11
Chromosomal Location99385254-99389364 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CGCC to CGCCGCC at 99386199 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103131] [ENSMUST00000211768]
Predicted Effect probably benign
Transcript: ENSMUST00000103131
SMART Domains Protein: ENSMUSP00000099420
Gene: ENSMUSG00000019761

DomainStartEndE-ValueType
low complexity region 2 133 N/A INTRINSIC
Filament 134 448 6e-166 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153599
Predicted Effect probably benign
Transcript: ENSMUST00000211768
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations may result in hyperkeratosis and blistering of the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 GTGGCGGCGGCGGC G 2: 25,272,537 probably null Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,918 probably benign Het
Cckbr CAG C 7: 105,434,687 probably null Het
Defb22 TGGCCT TGGCCTCTGCGGCAGAGCCGGCCT 2: 152,485,825 probably benign Het
Dmkn GGTGGAAGTGGTGGAAGTGGTGGAAGT GGTGGAAGTGGTGGAAGTGGTGGAAGTCGTGGAAGTGGTGGAAGTGGTGGAAGT 7: 30,767,175 probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,755 probably benign Het
Efhd2 CC CCGCCGAC 4: 141,874,774 probably benign Het
Fsip2 TTTT TTTTGTTT 2: 82,984,363 probably benign Het
Gm11060 CTGTGTG CTG 2: 105,092,040 probably null Het
Gm5591 GC G 7: 38,522,335 probably null Het
Nefh TGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGGGACTTGGCCTCACCGGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,028 probably benign Het
Nusap1 CAAGCTGAGA CAAGCTGAGATACACGTTAGCAGTGAGGAGGAAGCTGAGA 2: 119,627,601 probably benign Het
Nusap1 A ATACACGTTAGCAGTGAGGAGCAAGCTGAGG 2: 119,627,610 probably benign Het
Rfx4 CTCTCTCTCTCTCT CTCTCTCTCTCTCTCTATCTCTCTCTCTCT 10: 84,858,481 probably benign Het
St5 GGGCAGCCCTCACTGA G 7: 109,556,946 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tnfaip8 ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,831 probably benign Het
Zfp384 CCCAGGCCCAGGCCCAGGCCCAGG CCCAGGCCCAGGACCAGGCCCAGGCCCAGGCCCAGG 6: 125,036,466 probably benign Het
Other mutations in Krt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03179:Krt10 APN 11 99389218 unclassified probably benign
Rough-fur UTSW 11 99388818 missense probably damaging 0.99
FR4304:Krt10 UTSW 11 99386199 unclassified probably benign
FR4304:Krt10 UTSW 11 99389274 unclassified probably benign
FR4340:Krt10 UTSW 11 99386202 unclassified probably benign
FR4340:Krt10 UTSW 11 99386203 unclassified probably benign
FR4340:Krt10 UTSW 11 99389274 unclassified probably benign
FR4342:Krt10 UTSW 11 99386199 unclassified probably benign
FR4342:Krt10 UTSW 11 99386203 unclassified probably benign
FR4449:Krt10 UTSW 11 99389267 unclassified probably benign
FR4548:Krt10 UTSW 11 99389273 unclassified probably benign
FR4548:Krt10 UTSW 11 99389276 unclassified probably benign
FR4589:Krt10 UTSW 11 99389276 unclassified probably benign
FR4737:Krt10 UTSW 11 99386197 unclassified probably benign
FR4737:Krt10 UTSW 11 99389273 unclassified probably benign
FR4737:Krt10 UTSW 11 99389279 unclassified probably benign
R1386:Krt10 UTSW 11 99385920 splice site probably benign
R1553:Krt10 UTSW 11 99385980 nonsense probably null
R1737:Krt10 UTSW 11 99387387 missense possibly damaging 0.81
R2082:Krt10 UTSW 11 99388875 missense probably damaging 1.00
R2420:Krt10 UTSW 11 99387107 missense possibly damaging 0.53
R3409:Krt10 UTSW 11 99387261 missense probably damaging 1.00
R4027:Krt10 UTSW 11 99386193 unclassified probably benign
R4042:Krt10 UTSW 11 99386993 splice site probably null
R4043:Krt10 UTSW 11 99386993 splice site probably null
R4915:Krt10 UTSW 11 99387508 missense probably damaging 0.99
R5818:Krt10 UTSW 11 99388771 missense probably damaging 1.00
R6546:Krt10 UTSW 11 99387395 splice site probably null
R6762:Krt10 UTSW 11 99387057 missense possibly damaging 0.90
R6925:Krt10 UTSW 11 99388851 missense probably damaging 0.99
R6985:Krt10 UTSW 11 99385630 missense possibly damaging 0.66
R7196:Krt10 UTSW 11 99387545 missense probably damaging 1.00
R7772:Krt10 UTSW 11 99389087 missense unknown
R7849:Krt10 UTSW 11 99387606 missense probably damaging 1.00
R7932:Krt10 UTSW 11 99387606 missense probably damaging 1.00
RF057:Krt10 UTSW 11 99386199 unclassified probably benign
RF062:Krt10 UTSW 11 99389264 unclassified probably benign
X0024:Krt10 UTSW 11 99388022 missense probably damaging 1.00
X0062:Krt10 UTSW 11 99387499 missense probably null 1.00
Z1177:Krt10 UTSW 11 99386232 missense unknown
Predicted Primers PCR Primer
(F):5'- GACTTGAAACCTCCGCTTCC -3'
(R):5'- ACGAATGGCTGGAAACTAATCCAC -3'

Sequencing Primer
(F):5'- TGGCCTCCGCTGGAACTTC -3'
(R):5'- TGGCTGGAAACTAATCCACAAACTTG -3'
Posted On2019-12-04