Incidental Mutation 'RF063:F11r'
ID605448
Institutional Source Beutler Lab
Gene Symbol F11r
Ensembl Gene ENSMUSG00000038235
Gene NameF11 receptor
SynonymsJcam1, JAM-A, Ly106, ESTM33, BV11 antigen, JAM-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #RF063 (G1)
Quality Score111.457
Status Not validated
Chromosome1
Chromosomal Location171437535-171464603 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) CCCCCCCCC to CCCCCCCCCCC at 171461190 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043839]
PDB Structure
SOLUBLE PART OF THE JUNCTION ADHESION MOLECULE FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000043839
SMART Domains Protein: ENSMUSP00000041907
Gene: ENSMUSG00000038235

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGv 44 110 9.93e-8 SMART
IGc2 143 219 1.82e-6 SMART
transmembrane domain 239 261 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is an important regulator of tight junction assembly in epithelia. In addition, the encoded protein can act as (1) a receptor for reovirus, (2) a ligand for the integrin LFA1, involved in leukocyte transmigration, and (3) a platelet receptor. Multiple 5' alternatively spliced variants, encoding the same protein, have been identified but their biological validity has not been established. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased dendritic cell migratory ability and contact hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik CAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,883 probably benign Het
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
Abca2 G T 2: 25,447,397 E2421D probably damaging Het
Apc A AATAAAGCCC 18: 34,282,009 probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,141,256 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
Fam171b C CAGCAGA 2: 83,812,896 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTACGTGTGCTGGT 5: 110,378,139 probably benign Het
Fbrsl1 GTGCTGGTG GTGCTGGTGCGTCTGCTGGTG 5: 110,378,143 probably benign Het
Iqcf4 TCCTTTT TCCTTTTCCTTTTCCTTGTCCTTTTCCTTTTCCTTTGCCTTTT 9: 106,570,617 probably benign Het
Iqgap1 AGGCCACCACTGCTCACAGGTGCTGTACCT A 7: 80,723,751 probably null Het
Kmt2c GCT GCTCCT 5: 25,315,764 probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 29,021,443 probably null Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Med12l AGC AGCCGC 3: 59,275,973 probably benign Het
Rassf6 C CTGCCTCACTCATGGTCCTGTAGAGCAATGGGGATTA 5: 90,608,942 probably null Het
Sh3pxd2b TGTGCC TGTGCCCGTGCC 11: 32,423,051 probably benign Het
Sorcs2 ATACATACATACCT AT 5: 36,153,811 probably null Het
Sry TGCTGCTGCTGCTGCTG T Y: 2,662,595 probably null Het
Stard8 GAG GAGTAG X: 99,066,524 probably null Het
Tcof1 GATCCCCTTGGC GATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGATATCCCCTTGGC 18: 60,833,573 probably benign Het
Thegl CCAG CCAGCGATCCTCCCCAGTCCCGCAAGGTCAG 5: 77,016,426 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGTTGCTGCT 15: 72,801,324 probably benign Het
Vmn1r74 CAGAGCCACCAAGTACCT C 7: 11,847,140 probably null Het
Other mutations in F11r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:F11r APN 1 171462942 critical splice donor site probably null
IGL01431:F11r APN 1 171462909 missense probably damaging 1.00
R0481:F11r UTSW 1 171461279 missense probably benign 0.02
R0486:F11r UTSW 1 171460588 missense probably damaging 1.00
R1944:F11r UTSW 1 171461891 missense probably damaging 1.00
R1984:F11r UTSW 1 171461870 missense probably benign 0.02
R2423:F11r UTSW 1 171461623 missense possibly damaging 0.89
R3545:F11r UTSW 1 171461261 missense probably damaging 1.00
R3840:F11r UTSW 1 171460889 missense probably damaging 1.00
R3841:F11r UTSW 1 171460889 missense probably damaging 1.00
R4007:F11r UTSW 1 171461348 missense probably benign 0.35
R4744:F11r UTSW 1 171460598 missense probably benign 0.00
R4775:F11r UTSW 1 171461641 missense probably damaging 1.00
R6384:F11r UTSW 1 171460940 missense probably benign 0.01
R8052:F11r UTSW 1 171461623 missense possibly damaging 0.89
R8215:F11r UTSW 1 171463088 makesense probably null
R8217:F11r UTSW 1 171463088 makesense probably null
R8377:F11r UTSW 1 171437543 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCACTGTGCTTGGTACG -3'
(R):5'- TTCATGAAGGCCCGGGTTTTC -3'

Sequencing Primer
(F):5'- CCACGTAGTCTCATGTAGGCTTAAAG -3'
(R):5'- TCTTGGCATCTGCTGTAAGC -3'
Posted On2019-12-04