Mutagenetix > Incidental Mutations

Incidental Mutation 'R0114:Arnt2'

60545

Institutional Source

Beutler Lab

Gene Symbol

Arnt2

Ensembl Gene

ENSMUSG00000015709

Gene Name

aryl hydrocarbon receptor nuclear translocator 2

Synonyms

bHLHe1

MMRRC Submission

038400-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0114 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84246278-84410176 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 84347530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 63 (R63C)

Ref Sequence

ENSEMBL: ENSMUSP00000146599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085077] [ENSMUST00000207769] [ENSMUST00000208204] [ENSMUST00000208232] [ENSMUST00000208392] [ENSMUST00000208863] [ENSMUST00000208995] [ENSMUST00000209133]

AlphaFold

Q61324

Predicted Effect

probably damaging
Transcript: ENSMUST00000085077
AA Change: R74C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: R74C

Domain	Start	End	E-Value	Type
HLH	69	122	1.42e-14	SMART
PAS	137	204	1.28e-8	SMART
low complexity region	225	236	N/A	INTRINSIC
PAS	325	391	4.15e-8	SMART
PAC	398	441	7.93e-5	SMART
low complexity region	502	526	N/A	INTRINSIC
low complexity region	597	626	N/A	INTRINSIC
low complexity region	653	675	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207512

Predicted Effect

probably damaging
Transcript: ENSMUST00000207769
AA Change: R70C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000208204

Predicted Effect

probably damaging
Transcript: ENSMUST00000208232
AA Change: R63C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208392
AA Change: R59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208863
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208995
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000209133
AA Change: R63C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.9209

Coding Region Coverage

1x: 98.6%
3x: 97.4%
10x: 93.2%
20x: 79.2%

Validation Efficiency

100% (99/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	T	C	10: 28,985,982		probably benign	Het
4933427D14Rik	T	C	11: 72,195,799	Y262C	probably damaging	Het
Adamts1	C	A	16: 85,799,614	V379L	probably benign	Het
Akt3	T	C	1: 177,067,251	D260G	probably damaging	Het
Alms1	T	C	6: 85,619,803	L537P	probably benign	Het
Anln	A	T	9: 22,353,346	I876N	probably damaging	Het
Ano9	A	T	7: 141,103,239		probably benign	Het
Arhgef10l	T	C	4: 140,583,883	E218G	probably benign	Het
Atp9a	G	T	2: 168,710,856	Y63*	probably null	Het
Bmpr2	G	T	1: 59,815,340	C116F	probably damaging	Het
Cand1	T	C	10: 119,216,522	D233G	probably benign	Het
Cftr	A	T	6: 18,282,448	H1049L	probably damaging	Het
Ckap5	A	T	2: 91,620,112	D1975V	possibly damaging	Het
Cyp26c1	T	C	19: 37,686,633	V134A	probably benign	Het
Dnaic1	T	C	4: 41,605,686		probably benign	Het
Dpp10	T	C	1: 123,486,092	I163V	probably benign	Het
Fam151a	A	T	4: 106,734,004	I15F	possibly damaging	Het
Fanca	A	T	8: 123,288,491		probably null	Het
Fes	A	G	7: 80,378,035	V787A	probably damaging	Het
Fnip1	C	T	11: 54,487,801		probably benign	Het
Gabpb1	A	G	2: 126,653,574	I86T	probably damaging	Het
Gm1840	A	G	8: 5,640,359		noncoding transcript	Het
Gmds	A	T	13: 32,227,281	S57T	probably benign	Het
Gnpat	T	G	8: 124,883,357	D426E	probably benign	Het
Gnptab	C	A	10: 88,433,400	P655Q	possibly damaging	Het
Herc1	T	A	9: 66,461,846	F2941I	probably damaging	Het
Herc2	T	C	7: 56,153,774		probably benign	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Itga11	T	G	9: 62,735,293	V166G	probably damaging	Het
Itga11	T	C	9: 62,760,302	V639A	possibly damaging	Het
Itpr2	A	G	6: 146,312,879	F1490S	probably damaging	Het
Lama2	C	A	10: 26,993,068	E802*	probably null	Het
Lgi3	C	T	14: 70,531,029		probably benign	Het
Limch1	C	T	5: 67,036,084		probably benign	Het
Lipc	T	C	9: 70,803,781	N363S	probably damaging	Het
Lrit2	A	G	14: 37,068,045		probably null	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mug2	A	G	6: 122,040,648	Y448C	probably damaging	Het
Mybpc3	A	G	2: 91,124,494	E450G	probably damaging	Het
Myo5b	A	T	18: 74,742,171	T1549S	probably benign	Het
Naa15	T	C	3: 51,448,438		probably null	Het
Nckap1l	T	A	15: 103,455,028	C54S	probably benign	Het
Nlrp9b	A	G	7: 20,024,056	D406G	probably benign	Het
Nprl3	T	A	11: 32,239,784		probably benign	Het
Nvl	A	G	1: 181,120,391	V429A	probably benign	Het
Olfr114	A	T	17: 37,589,415	*313K	probably null	Het
Olfr54	G	A	11: 51,027,604	V201I	probably benign	Het
Olfr548-ps1	A	T	7: 102,542,731	Q265L	probably benign	Het
Olfr801	T	A	10: 129,669,598	Y307F	probably benign	Het
Opa1	A	T	16: 29,629,635	N912Y	probably benign	Het
Pcnx	T	C	12: 81,996,095	V2317A	possibly damaging	Het
Phf3	A	T	1: 30,805,443	N1478K	possibly damaging	Het
Phykpl	G	A	11: 51,586,653	D91N	probably benign	Het
Polr2b	T	A	5: 77,343,263	C984S	probably damaging	Het
Ppfibp1	A	G	6: 146,998,233	R141G	probably benign	Het
Ppm1d	G	A	11: 85,326,905	G20R	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ppp2r5b	C	A	19: 6,228,431	V483F	probably benign	Het
Ppp4r4	T	A	12: 103,576,374	C132S	probably benign	Het
Prg2	A	G	2: 84,983,456		probably benign	Het
Prpf4b	G	A	13: 34,890,488		probably benign	Het
Rad54l2	T	C	9: 106,713,455	T491A	probably damaging	Het
Rnf213	G	T	11: 119,414,587	W548L	probably damaging	Het
Rusc2	G	T	4: 43,422,055	C825F	probably damaging	Het
Sema4b	A	G	7: 80,219,078		probably benign	Het
Sema6a	A	G	18: 47,290,177	V254A	probably damaging	Het
Slc13a3	A	G	2: 165,424,581	F346L	probably damaging	Het
Slc25a17	T	C	15: 81,337,959	D104G	probably damaging	Het
Specc1	A	T	11: 62,146,313	N707Y	possibly damaging	Het
Tex48	T	A	4: 63,608,459	E76V	probably damaging	Het
Tfr2	T	C	5: 137,577,465	V281A	probably benign	Het
Tgfb1i1	A	C	7: 128,249,494	Q238H	probably damaging	Het
Thoc6	G	A	17: 23,670,239	T122I	probably benign	Het
Tmtc1	G	A	6: 148,412,830		probably benign	Het
Tnfrsf8	T	C	4: 145,288,047	D264G	possibly damaging	Het
Trim43a	T	A	9: 88,584,160	I178N	probably damaging	Het
Ttn	G	C	2: 76,707,093	I26503M	possibly damaging	Het
Usp28	C	A	9: 49,039,023	D589E	probably benign	Het
Utp23	T	C	15: 51,882,511	S242P	probably damaging	Het
Vwa3a	A	G	7: 120,775,380	Y305C	probably benign	Het
Vwa5b1	C	A	4: 138,608,858	E142*	probably null	Het
Xrn2	A	T	2: 147,029,779	T374S	probably damaging	Het
Zfp735	A	T	11: 73,710,662	Q144L	probably benign	Het

Other mutations in Arnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Arnt2	APN	7	84285829	missense	probably benign	0.01
IGL01525:Arnt2	APN	7	84275408	missense	possibly damaging	0.70
IGL02331:Arnt2	APN	7	84265624	missense	probably damaging	1.00
IGL02483:Arnt2	APN	7	84251397	missense	probably damaging	1.00
IGL02863:Arnt2	APN	7	84267937	missense	probably damaging	1.00
IGL03207:Arnt2	APN	7	84343834	missense	possibly damaging	0.93
Arnold2	UTSW	7	84347530	missense	probably damaging	1.00
porker	UTSW	7	84343942	missense	probably damaging	1.00
R0024:Arnt2	UTSW	7	84284126	missense	probably benign	0.03
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0060:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0113:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0201:Arnt2	UTSW	7	84361659	nonsense	probably null
R0514:Arnt2	UTSW	7	84304859	missense	probably benign	0.00
R0863:Arnt2	UTSW	7	84265584	missense	probably damaging	1.00
R1800:Arnt2	UTSW	7	84275375	missense	probably damaging	1.00
R1944:Arnt2	UTSW	7	84343751	missense	probably benign	0.01
R1964:Arnt2	UTSW	7	84343789	missense	possibly damaging	0.55
R2061:Arnt2	UTSW	7	84343870	missense	probably damaging	1.00
R2216:Arnt2	UTSW	7	84275351	missense	probably damaging	0.99
R3107:Arnt2	UTSW	7	84262444	missense	possibly damaging	0.95
R3410:Arnt2	UTSW	7	84275447	missense	probably damaging	1.00
R3739:Arnt2	UTSW	7	84343801	missense	probably null	1.00
R4258:Arnt2	UTSW	7	84310955	missense	probably damaging	0.98
R4486:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4489:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4668:Arnt2	UTSW	7	84275386	missense	probably damaging	1.00
R5685:Arnt2	UTSW	7	84263265	missense	probably benign	0.00
R5876:Arnt2	UTSW	7	84347512	missense	probably damaging	1.00
R5923:Arnt2	UTSW	7	84262533	missense	probably benign	0.32
R5926:Arnt2	UTSW	7	84343946	missense	probably damaging	0.99
R6122:Arnt2	UTSW	7	84361565	missense	probably damaging	1.00
R7021:Arnt2	UTSW	7	84343942	missense	probably damaging	1.00
R7895:Arnt2	UTSW	7	84305198	missense	probably benign
R7898:Arnt2	UTSW	7	84268947	splice site	probably null
R8386:Arnt2	UTSW	7	84347539	missense	probably damaging	1.00
R9038:Arnt2	UTSW	7	84304851	missense	probably benign
R9258:Arnt2	UTSW	7	84361590	missense	probably damaging	1.00
R9346:Arnt2	UTSW	7	84282113	missense	probably benign	0.04
R9452:Arnt2	UTSW	7	84284126	missense	probably benign	0.03
X0066:Arnt2	UTSW	7	84285784	missense	possibly damaging	0.93
Z1176:Arnt2	UTSW	7	84263196	missense	probably benign	0.41
Z1177:Arnt2	UTSW	7	84263207	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- TCTGCCACTCTTGAAGAGTACCTCC -3'
(R):5'- TTCCATGCTCCCTGGTCAAAAGTC -3'

Sequencing Primer
(F):5'- CCTCCTTTTGAAGAATGGAAGCC -3'
(R):5'- CCCGAGTTACAGATGTGTCAG -3'

Posted On

2013-07-24