Incidental Mutation 'RF063:Fam171b'
ID605450
Institutional Source Beutler Lab
Gene Symbol Fam171b
Ensembl Gene ENSMUSG00000048388
Gene Namefamily with sequence similarity 171, member B
SynonymsD430039N05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #RF063 (G1)
Quality Score217.468
Status Not validated
Chromosome2
Chromosomal Location83812636-83883486 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) C to CAGCAGA at 83812896 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051454]
Predicted Effect probably benign
Transcript: ENSMUST00000051454
SMART Domains Protein: ENSMUSP00000062702
Gene: ENSMUSG00000048388

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
Pfam:UPF0560 80 591 4.3e-101 PFAM
Pfam:UPF0560 583 821 6.7e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik CAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,883 probably benign Het
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
Abca2 G T 2: 25,447,397 E2421D probably damaging Het
Apc A AATAAAGCCC 18: 34,282,009 probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,141,256 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
F11r CCCCCCCCC CCCCCCCCCCC 1: 171,461,190 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTACGTGTGCTGGT 5: 110,378,139 probably benign Het
Fbrsl1 GTGCTGGTG GTGCTGGTGCGTCTGCTGGTG 5: 110,378,143 probably benign Het
Iqcf4 TCCTTTT TCCTTTTCCTTTTCCTTGTCCTTTTCCTTTTCCTTTGCCTTTT 9: 106,570,617 probably benign Het
Iqgap1 AGGCCACCACTGCTCACAGGTGCTGTACCT A 7: 80,723,751 probably null Het
Kmt2c GCT GCTCCT 5: 25,315,764 probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 29,021,443 probably null Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Med12l AGC AGCCGC 3: 59,275,973 probably benign Het
Rassf6 C CTGCCTCACTCATGGTCCTGTAGAGCAATGGGGATTA 5: 90,608,942 probably null Het
Sh3pxd2b TGTGCC TGTGCCCGTGCC 11: 32,423,051 probably benign Het
Sorcs2 ATACATACATACCT AT 5: 36,153,811 probably null Het
Sry TGCTGCTGCTGCTGCTG T Y: 2,662,595 probably null Het
Stard8 GAG GAGTAG X: 99,066,524 probably null Het
Tcof1 GATCCCCTTGGC GATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGATATCCCCTTGGC 18: 60,833,573 probably benign Het
Thegl CCAG CCAGCGATCCTCCCCAGTCCCGCAAGGTCAG 5: 77,016,426 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGTTGCTGCT 15: 72,801,324 probably benign Het
Vmn1r74 CAGAGCCACCAAGTACCT C 7: 11,847,140 probably null Het
Other mutations in Fam171b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Fam171b APN 2 83876728 nonsense probably null
IGL01309:Fam171b APN 2 83879447 nonsense probably null
IGL01515:Fam171b APN 2 83880233 missense probably damaging 0.99
IGL01604:Fam171b APN 2 83879600 missense possibly damaging 0.50
IGL01729:Fam171b APN 2 83855537 splice site probably benign
IGL01784:Fam171b APN 2 83879687 missense possibly damaging 0.83
P0028:Fam171b UTSW 2 83853439 missense probably damaging 1.00
R1203:Fam171b UTSW 2 83812969 missense probably benign 0.05
R1530:Fam171b UTSW 2 83880189 missense probably damaging 1.00
R1539:Fam171b UTSW 2 83880098 missense probably benign 0.00
R1564:Fam171b UTSW 2 83880284 missense probably damaging 1.00
R1858:Fam171b UTSW 2 83853381 missense probably benign
R1940:Fam171b UTSW 2 83812874 small deletion probably benign
R2131:Fam171b UTSW 2 83879858 missense probably damaging 0.97
R3746:Fam171b UTSW 2 83879600 missense probably damaging 1.00
R3777:Fam171b UTSW 2 83878261 missense probably benign 0.03
R3840:Fam171b UTSW 2 83880062 missense possibly damaging 0.76
R4920:Fam171b UTSW 2 83880359 missense possibly damaging 0.73
R5007:Fam171b UTSW 2 83855509 nonsense probably null
R5178:Fam171b UTSW 2 83879987 missense probably damaging 1.00
R5282:Fam171b UTSW 2 83853605 critical splice donor site probably null
R5544:Fam171b UTSW 2 83855527 missense possibly damaging 0.58
R5614:Fam171b UTSW 2 83812873 missense probably damaging 0.99
R5786:Fam171b UTSW 2 83878236 missense probably benign 0.38
R6190:Fam171b UTSW 2 83876698 missense probably benign
R6247:Fam171b UTSW 2 83879208 missense probably damaging 1.00
R6309:Fam171b UTSW 2 83860460 missense probably damaging 0.99
R6324:Fam171b UTSW 2 83879264 nonsense probably null
R7127:Fam171b UTSW 2 83879766 missense probably benign 0.25
R7201:Fam171b UTSW 2 83878230 missense probably damaging 1.00
R7223:Fam171b UTSW 2 83878230 missense probably damaging 1.00
R7689:Fam171b UTSW 2 83879388 missense probably benign 0.38
R7904:Fam171b UTSW 2 83853505 missense probably damaging 0.97
R8069:Fam171b UTSW 2 83812874 small deletion probably benign
R8236:Fam171b UTSW 2 83880206 missense probably damaging 0.97
R8252:Fam171b UTSW 2 83878242 missense probably benign 0.00
R8458:Fam171b UTSW 2 83860520 missense probably benign 0.21
RF001:Fam171b UTSW 2 83812886 small insertion probably benign
RF009:Fam171b UTSW 2 83812880 small insertion probably benign
RF011:Fam171b UTSW 2 83812873 small insertion probably benign
RF011:Fam171b UTSW 2 83812895 small insertion probably benign
RF013:Fam171b UTSW 2 83812895 small insertion probably benign
RF027:Fam171b UTSW 2 83812876 small insertion probably benign
RF029:Fam171b UTSW 2 83812892 small insertion probably benign
RF036:Fam171b UTSW 2 83812892 small insertion probably benign
RF055:Fam171b UTSW 2 83812876 small insertion probably benign
RF056:Fam171b UTSW 2 83812896 small insertion probably benign
RF060:Fam171b UTSW 2 83812877 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCACCTTGCAGAGCACTTG -3'
(R):5'- TTTCCCACCCGAGCAAAGAG -3'

Sequencing Primer
(F):5'- CGCAATATGCCTCCGTGG -3'
(R):5'- GCAACCTGGGAAGACGC -3'
Posted On2019-12-04