Mutagenetix > Incidental Mutation

Incidental Mutation 'RF063:Casz1'

605453

Institutional Source

Beutler Lab

Gene Symbol

Casz1

Ensembl Gene

ENSMUSG00000028977

Gene Name

castor zinc finger 1

Synonyms

D4Ertd432e, 2410019P08Rik, Cst, castor

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

RF063 (G1)

Quality Score

170.457

Status

Not validated

Chromosome

Chromosomal Location

148804429-148954889 bp(+) (GRCm38)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

CACA to C at 148952304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000112978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122222]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000122222

SMART Domains

Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977

Domain	Start	End	E-Value	Type
low complexity region	403	420	N/A	INTRINSIC
ZnF_C2H2	489	514	5.34e0	SMART
ZnF_C2H2	550	574	8.09e-1	SMART
ZnF_C2H2	609	633	9.3e-1	SMART
low complexity region	643	658	N/A	INTRINSIC
ZnF_C2H2	667	691	1.1e-2	SMART
low complexity region	698	711	N/A	INTRINSIC
low complexity region	728	766	N/A	INTRINSIC
low complexity region	796	807	N/A	INTRINSIC
low complexity region	810	834	N/A	INTRINSIC
low complexity region	875	890	N/A	INTRINSIC
low complexity region	951	957	N/A	INTRINSIC
ZnF_C2H2	1031	1055	2.29e1	SMART
low complexity region	1080	1091	N/A	INTRINSIC
low complexity region	1105	1115	N/A	INTRINSIC
ZnF_C2H2	1182	1206	1.59e1	SMART
ZnF_C2H2	1242	1266	2.47e1	SMART
ZnF_C2H2	1300	1324	3.47e0	SMART
ZnF_C2H2	1457	1481	7.89e0	SMART
ZnF_C2H2	1515	1537	3.21e1	SMART
ZnF_C2H2	1571	1595	3.99e0	SMART
low complexity region	1632	1649	N/A	INTRINSIC
SCOP:d1qbkb_	1675	1742	2e-5	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.3%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430401F13Rik	CAGAAAGGAAAAGGTGGCCAG	CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG	6: 131,552,883		probably benign	Het
5430401F13Rik	AGAAAGGAAAAGGTGGCCAG	AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG	6: 131,552,884		probably benign	Het
Abca2	G	T	2: 25,447,397	E2421D	probably damaging	Het
Apc	A	AATAAAGCCC	18: 34,282,009		probably benign	Het
Calhm1	TGGCTGTGGCTG	TGGCTGTGGCTGCGGCTGTGGCTG	19: 47,141,256		probably benign	Het
Dock4	GTGCCGGTGCCCGT	G	12: 40,844,399		probably null	Het
F11r	CCCCCCCCC	CCCCCCCCCCC	1: 171,461,190		probably benign	Het
Fam171b	C	CAGCAGA	2: 83,812,896		probably benign	Het
Fbrsl1	GCGTGTGCTGGT	GCGTGTGCTGGTACGTGTGCTGGT	5: 110,378,139		probably benign	Het
Fbrsl1	GTGCTGGTG	GTGCTGGTGCGTCTGCTGGTG	5: 110,378,143		probably benign	Het
Iqcf4	TCCTTTT	TCCTTTTCCTTTTCCTTGTCCTTTTCCTTTTCCTTTGCCTTTT	9: 106,570,617		probably benign	Het
Iqgap1	AGGCCACCACTGCTCACAGGTGCTGTACCT	A	7: 80,723,751		probably null	Het
Kmt2c	GCT	GCTCCT	5: 25,315,764		probably benign	Het
Lrtm1	TAGCCTCAGTGGCC	T	14: 29,021,443		probably null	Het
Med12l	AACA	AACAACA	3: 59,275,958		probably benign	Het
Med12l	AGC	AGCCGC	3: 59,275,973		probably benign	Het
Rassf6	C	CTGCCTCACTCATGGTCCTGTAGAGCAATGGGGATTA	5: 90,608,942		probably null	Het
Sh3pxd2b	TGTGCC	TGTGCCCGTGCC	11: 32,423,051		probably benign	Het
Sorcs2	ATACATACATACCT	AT	5: 36,153,811		probably null	Het
Sry	TGCTGCTGCTGCTGCTG	T	Y: 2,662,595		probably null	Het
Stard8	GAG	GAGTAG	X: 99,066,524		probably null	Het
Tcof1	GATCCCCTTGGC	GATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGATATCCCCTTGGC	18: 60,833,573		probably benign	Het
Thegl	CCAG	CCAGCGATCCTCCCCAGTCCCGCAAGGTCAG	5: 77,016,426		probably benign	Het
Trappc9	GCTGCTGCTGCT	GCTGCTGCTGCTGCTTCTGCTGCTGCT	15: 72,801,320		probably benign	Het
Trappc9	CTGCTGCT	CTGCTGCTGCTGCTGTTGCTGCT	15: 72,801,324		probably benign	Het
Vmn1r74	CAGAGCCACCAAGTACCT	C	7: 11,847,140		probably null	Het

Other mutations in Casz1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00914:Casz1	APN	4	148929371	missense	probably damaging	1.00
IGL02137:Casz1	APN	4	148933468	missense	possibly damaging	0.71
IGL02176:Casz1	APN	4	148934619	missense	probably damaging	1.00
IGL02629:Casz1	APN	4	148944391	missense	probably benign	0.01
IGL02871:Casz1	APN	4	148944319	missense	possibly damaging	0.93
FR4340:Casz1	UTSW	4	148952302	small deletion	probably benign
G1Funyon:Casz1	UTSW	4	148946043	missense	probably damaging	0.98
H8562:Casz1	UTSW	4	148933451	missense	probably damaging	1.00
R0090:Casz1	UTSW	4	148933411	missense	probably benign	0.00
R0389:Casz1	UTSW	4	148948911	missense	possibly damaging	0.83
R0443:Casz1	UTSW	4	148948911	missense	possibly damaging	0.83
R0550:Casz1	UTSW	4	148952284	small deletion	probably benign
R0597:Casz1	UTSW	4	148944394	missense	probably benign	0.00
R1117:Casz1	UTSW	4	148934595	missense	probably damaging	1.00
R1476:Casz1	UTSW	4	148946171	missense	probably benign	0.05
R1540:Casz1	UTSW	4	148942900	unclassified	probably benign
R1610:Casz1	UTSW	4	148929087	missense	possibly damaging	0.54
R1764:Casz1	UTSW	4	148942900	unclassified	probably benign
R1779:Casz1	UTSW	4	148932937	missense	probably benign	0.00
R1874:Casz1	UTSW	4	148943211	missense	probably damaging	0.99
R1902:Casz1	UTSW	4	148936195	missense	possibly damaging	0.95
R1914:Casz1	UTSW	4	148932958	missense	probably damaging	1.00
R2126:Casz1	UTSW	4	148946064	missense	probably damaging	0.99
R2261:Casz1	UTSW	4	148929099	missense	probably damaging	0.96
R2262:Casz1	UTSW	4	148929099	missense	probably damaging	0.96
R3874:Casz1	UTSW	4	148939589	intron	probably benign
R4019:Casz1	UTSW	4	148932878	missense	probably benign	0.00
R4355:Casz1	UTSW	4	148952335	missense	unknown
R4420:Casz1	UTSW	4	148948918	missense	possibly damaging	0.90
R4610:Casz1	UTSW	4	148933267	missense	probably damaging	1.00
R4632:Casz1	UTSW	4	148951855	missense	possibly damaging	0.71
R4762:Casz1	UTSW	4	148938981	missense	probably damaging	1.00
R4824:Casz1	UTSW	4	148944571	missense	probably damaging	1.00
R4907:Casz1	UTSW	4	148944541	missense	probably damaging	1.00
R5628:Casz1	UTSW	4	148946096	missense	probably damaging	1.00
R5736:Casz1	UTSW	4	148929410	missense	probably benign	0.00
R5929:Casz1	UTSW	4	148938696	missense	probably damaging	1.00
R5929:Casz1	UTSW	4	148938969	missense	probably damaging	1.00
R5932:Casz1	UTSW	4	148939113	missense	possibly damaging	0.52
R6016:Casz1	UTSW	4	148934584	missense	probably damaging	1.00
R6019:Casz1	UTSW	4	148947038	missense	probably damaging	0.99
R6139:Casz1	UTSW	4	148951697	missense	probably damaging	1.00
R6223:Casz1	UTSW	4	148933383	missense	probably damaging	1.00
R6239:Casz1	UTSW	4	148938277	missense	probably damaging	1.00
R6323:Casz1	UTSW	4	148941704	missense	possibly damaging	0.89
R6354:Casz1	UTSW	4	148952542	missense	unknown
R6454:Casz1	UTSW	4	148951495	missense	probably damaging	0.99
R6479:Casz1	UTSW	4	148937078	missense	probably damaging	1.00
R6529:Casz1	UTSW	4	148938189	missense	probably damaging	1.00
R6772:Casz1	UTSW	4	148943206	missense	probably damaging	1.00
R7000:Casz1	UTSW	4	148929236	missense	probably damaging	1.00
R7152:Casz1	UTSW	4	148901291	start gained	probably benign
R7324:Casz1	UTSW	4	148947033	missense	probably damaging	0.99
R7339:Casz1	UTSW	4	148951745	missense	probably damaging	1.00
R7388:Casz1	UTSW	4	148952393	missense	unknown
R7480:Casz1	UTSW	4	148944586	missense	probably damaging	0.99
R7719:Casz1	UTSW	4	148944524	missense	probably damaging	0.99
R7789:Casz1	UTSW	4	148929406	missense	probably benign
R7801:Casz1	UTSW	4	148938249	missense	probably damaging	0.99
R7815:Casz1	UTSW	4	148929305	missense	possibly damaging	0.89
R7818:Casz1	UTSW	4	148946076	missense	probably damaging	1.00
R7938:Casz1	UTSW	4	148944486	missense	probably benign	0.05
R8045:Casz1	UTSW	4	148932779	missense	probably damaging	1.00
R8134:Casz1	UTSW	4	148943035	missense	probably damaging	1.00
R8165:Casz1	UTSW	4	148944431	missense	probably damaging	1.00
R8301:Casz1	UTSW	4	148946043	missense	probably damaging	0.98
R8419:Casz1	UTSW	4	148948583	missense	probably benign	0.29
R9047:Casz1	UTSW	4	148939040	missense	probably damaging	1.00
R9420:Casz1	UTSW	4	148938863	missense	probably damaging	0.99
R9584:Casz1	UTSW	4	148901247	start gained	probably benign
RF001:Casz1	UTSW	4	148952304	small deletion	probably benign
X0018:Casz1	UTSW	4	148939008	missense	probably damaging	1.00
X0064:Casz1	UTSW	4	148932952	missense	probably damaging	0.99
Z1088:Casz1	UTSW	4	148944359	missense	probably benign
Z1176:Casz1	UTSW	4	148944359	missense	probably benign
Z1177:Casz1	UTSW	4	148933306	missense	probably damaging	1.00
Z1177:Casz1	UTSW	4	148944359	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAAGCTCAAGTGCTCGCAC -3'
(R):5'- GGGTTCACATACAGAGCAGTTC -3'

Sequencing Primer
(F):5'- TCGCAGATGGACTCGCACAAG -3'
(R):5'- TTCACATACAGAGCAGTTCTAGAGG -3'

Posted On

2019-12-04