Incidental Mutation 'RF063:Fbrsl1'
Institutional Source Beutler Lab
Gene Symbol Fbrsl1
Ensembl Gene ENSMUSG00000043323
Gene Namefibrosin-like 1
Synonyms2410025L10Rik, LOC381668
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #RF063 (G1)
Quality Score214.461
Status Not validated
Chromosomal Location110361754-110448503 bp(-) (GRCm38)
Type of Mutationsmall insertion (4 aa in frame mutation)
DNA Base Change (assembly) GTGCTGGTG to GTGCTGGTGCGTCTGCTGGTG at 110378143 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056124] [ENSMUST00000069483] [ENSMUST00000196801] [ENSMUST00000198768] [ENSMUST00000198834]
AlphaFold E9Q9T0
Predicted Effect probably benign
Transcript: ENSMUST00000056124
SMART Domains Protein: ENSMUSP00000054613
Gene: ENSMUSG00000043323

low complexity region 3 16 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 82 100 N/A INTRINSIC
Pfam:Auts2 125 329 3.1e-96 PFAM
low complexity region 464 480 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069483
SMART Domains Protein: ENSMUSP00000063879
Gene: ENSMUSG00000043323

low complexity region 6 30 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
low complexity region 269 286 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 377 410 N/A INTRINSIC
low complexity region 476 493 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Pfam:Auts2 564 767 1.9e-95 PFAM
low complexity region 902 918 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
low complexity region 966 980 N/A INTRINSIC
low complexity region 981 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196801
SMART Domains Protein: ENSMUSP00000142625
Gene: ENSMUSG00000043323

low complexity region 6 30 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
low complexity region 269 286 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 377 410 N/A INTRINSIC
low complexity region 447 456 N/A INTRINSIC
low complexity region 489 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198768
SMART Domains Protein: ENSMUSP00000142379
Gene: ENSMUSG00000043323

low complexity region 17 38 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198834
SMART Domains Protein: ENSMUSP00000143147
Gene: ENSMUSG00000043323

low complexity region 3 16 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 82 100 N/A INTRINSIC
Pfam:Auts2 150 353 4.1e-107 PFAM
low complexity region 488 504 N/A INTRINSIC
low complexity region 522 537 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G T 2: 25,447,397 E2421D probably damaging Het
Apc A AATAAAGCCC 18: 34,282,009 probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,141,256 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
F11r CCCCCCCCC CCCCCCCCCCC 1: 171,461,190 probably benign Het
Fam171b C CAGCAGA 2: 83,812,896 probably benign Het
Iqgap1 AGGCCACCACTGCTCACAGGTGCTGTACCT A 7: 80,723,751 probably null Het
Kmt2c GCT GCTCCT 5: 25,315,764 probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 29,021,443 probably null Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Med12l AGC AGCCGC 3: 59,275,973 probably benign Het
Sh3pxd2b TGTGCC TGTGCCCGTGCC 11: 32,423,051 probably benign Het
Sorcs2 ATACATACATACCT AT 5: 36,153,811 probably null Het
Sry TGCTGCTGCTGCTGCTG T Y: 2,662,595 probably null Het
Stard8 GAG GAGTAG X: 99,066,524 probably null Het
Thegl CCAG CCAGCGATCCTCCCCAGTCCCGCAAGGTCAG 5: 77,016,426 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGTTGCTGCT 15: 72,801,324 probably benign Het
Vmn1r74 CAGAGCCACCAAGTACCT C 7: 11,847,140 probably null Het
Other mutations in Fbrsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Fbrsl1 APN 5 110378248 missense probably damaging 0.99
IGL01743:Fbrsl1 APN 5 110381640 missense probably damaging 0.98
IGL01910:Fbrsl1 APN 5 110363736 missense probably damaging 1.00
F5770:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
FR4342:Fbrsl1 UTSW 5 110378125 small insertion probably benign
FR4589:Fbrsl1 UTSW 5 110378150 small insertion probably benign
R0084:Fbrsl1 UTSW 5 110379515 missense probably damaging 0.99
R0126:Fbrsl1 UTSW 5 110396040 splice site probably benign
R0336:Fbrsl1 UTSW 5 110447951 missense probably damaging 0.96
R1196:Fbrsl1 UTSW 5 110374519 missense probably benign 0.21
R1712:Fbrsl1 UTSW 5 110447996 missense probably benign 0.01
R1998:Fbrsl1 UTSW 5 110376439 missense probably benign 0.43
R2081:Fbrsl1 UTSW 5 110371625 critical splice acceptor site probably null
R2108:Fbrsl1 UTSW 5 110378434 missense probably damaging 0.97
R4420:Fbrsl1 UTSW 5 110378986 missense possibly damaging 0.66
R4472:Fbrsl1 UTSW 5 110379066 start gained probably benign
R4931:Fbrsl1 UTSW 5 110379029 missense possibly damaging 0.89
R4994:Fbrsl1 UTSW 5 110447951 missense probably damaging 0.96
R5025:Fbrsl1 UTSW 5 110417901 missense probably damaging 0.99
R5084:Fbrsl1 UTSW 5 110379406 start gained probably benign
R5326:Fbrsl1 UTSW 5 110378441 missense probably damaging 1.00
R5542:Fbrsl1 UTSW 5 110378441 missense probably damaging 1.00
R5590:Fbrsl1 UTSW 5 110381618 missense probably damaging 0.96
R6168:Fbrsl1 UTSW 5 110396056 missense probably damaging 0.97
R6234:Fbrsl1 UTSW 5 110378051 missense probably damaging 0.97
R6325:Fbrsl1 UTSW 5 110377407 missense probably damaging 1.00
R6661:Fbrsl1 UTSW 5 110378097 missense probably damaging 1.00
R7269:Fbrsl1 UTSW 5 110433014 missense probably benign 0.15
R7514:Fbrsl1 UTSW 5 110432933 missense probably benign 0.06
R7586:Fbrsl1 UTSW 5 110378154 missense probably damaging 0.99
R7791:Fbrsl1 UTSW 5 110448019 missense probably benign 0.00
R8108:Fbrsl1 UTSW 5 110378379 splice site probably null
R8182:Fbrsl1 UTSW 5 110378995 missense possibly damaging 0.46
R8679:Fbrsl1 UTSW 5 110378220 missense probably damaging 1.00
RF008:Fbrsl1 UTSW 5 110378118 small insertion probably benign
RF029:Fbrsl1 UTSW 5 110378139 small insertion probably benign
RF031:Fbrsl1 UTSW 5 110378151 small insertion probably benign
RF033:Fbrsl1 UTSW 5 110378125 small insertion probably benign
RF034:Fbrsl1 UTSW 5 110378149 small insertion probably benign
RF037:Fbrsl1 UTSW 5 110378151 nonsense probably null
RF061:Fbrsl1 UTSW 5 110378131 small insertion probably benign
RF063:Fbrsl1 UTSW 5 110378139 small insertion probably benign
RF064:Fbrsl1 UTSW 5 110378131 small insertion probably benign
V7582:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0018:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0019:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0020:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0021:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0022:Fbrsl1 UTSW 5 110371549 missense probably damaging 1.00
X0022:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0023:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0024:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0027:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0050:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0052:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0053:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0054:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0057:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0058:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0060:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0061:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0062:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0063:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0064:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0065:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0066:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0067:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04