Incidental Mutation 'RF063:5430401F13Rik'
ID605460
Institutional Source Beutler Lab
Gene Symbol 5430401F13Rik
Ensembl Gene ENSMUSG00000094113
Gene NameRIKEN cDNA 5430401F13 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #RF063 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location131486400-131553763 bp(+) (GRCm38)
Type of Mutationsmall insertion (9 aa in frame mutation)
DNA Base Change (assembly) CAGAAAGGAAAAGGTGGCCAG to CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG at 131552883 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075020] [ENSMUST00000161385]
Predicted Effect probably benign
Transcript: ENSMUST00000075020
SMART Domains Protein: ENSMUSP00000074539
Gene: ENSMUSG00000094113

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 100 116 N/A INTRINSIC
low complexity region 118 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161385
SMART Domains Protein: ENSMUSP00000125129
Gene: ENSMUSG00000094113

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 100 116 N/A INTRINSIC
low complexity region 118 166 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G T 2: 25,447,397 E2421D probably damaging Het
Apc A AATAAAGCCC 18: 34,282,009 probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,141,256 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
F11r CCCCCCCCC CCCCCCCCCCC 1: 171,461,190 probably benign Het
Fam171b C CAGCAGA 2: 83,812,896 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTACGTGTGCTGGT 5: 110,378,139 probably benign Het
Fbrsl1 GTGCTGGTG GTGCTGGTGCGTCTGCTGGTG 5: 110,378,143 probably benign Het
Iqcf4 TCCTTTT TCCTTTTCCTTTTCCTTGTCCTTTTCCTTTTCCTTTGCCTTTT 9: 106,570,617 probably benign Het
Iqgap1 AGGCCACCACTGCTCACAGGTGCTGTACCT A 7: 80,723,751 probably null Het
Kmt2c GCT GCTCCT 5: 25,315,764 probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 29,021,443 probably null Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Med12l AGC AGCCGC 3: 59,275,973 probably benign Het
Rassf6 C CTGCCTCACTCATGGTCCTGTAGAGCAATGGGGATTA 5: 90,608,942 probably null Het
Sh3pxd2b TGTGCC TGTGCCCGTGCC 11: 32,423,051 probably benign Het
Sorcs2 ATACATACATACCT AT 5: 36,153,811 probably null Het
Sry TGCTGCTGCTGCTGCTG T Y: 2,662,595 probably null Het
Stard8 GAG GAGTAG X: 99,066,524 probably null Het
Tcof1 GATCCCCTTGGC GATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGATATCCCCTTGGC 18: 60,833,573 probably benign Het
Thegl CCAG CCAGCGATCCTCCCCAGTCCCGCAAGGTCAG 5: 77,016,426 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGTTGCTGCT 15: 72,801,324 probably benign Het
Vmn1r74 CAGAGCCACCAAGTACCT C 7: 11,847,140 probably null Het
Other mutations in 5430401F13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02737:5430401F13Rik APN 6 131552592 missense probably benign 0.14
R0866:5430401F13Rik UTSW 6 131552779 missense unknown
R1674:5430401F13Rik UTSW 6 131552803 missense unknown
R6374:5430401F13Rik UTSW 6 131552929 missense unknown
R6671:5430401F13Rik UTSW 6 131551350 critical splice donor site probably null
R7150:5430401F13Rik UTSW 6 131552667 missense probably benign 0.16
RF005:5430401F13Rik UTSW 6 131552884 small insertion probably benign
RF014:5430401F13Rik UTSW 6 131552857 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552856 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552859 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552861 small insertion probably benign
RF023:5430401F13Rik UTSW 6 131552855 small insertion probably benign
RF023:5430401F13Rik UTSW 6 131552878 small insertion probably benign
RF029:5430401F13Rik UTSW 6 131552895 small insertion probably benign
RF037:5430401F13Rik UTSW 6 131552887 small insertion probably benign
RF037:5430401F13Rik UTSW 6 131552888 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552873 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552892 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552894 small insertion probably benign
RF042:5430401F13Rik UTSW 6 131552886 small insertion probably benign
RF058:5430401F13Rik UTSW 6 131552887 small insertion probably benign
RF058:5430401F13Rik UTSW 6 131552901 small insertion probably benign
RF063:5430401F13Rik UTSW 6 131552884 small insertion probably benign
X0062:5430401F13Rik UTSW 6 131552638 missense probably benign 0.29
Z1177:5430401F13Rik UTSW 6 131552721 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGGTAAGGAAGCCATCAAGTCC -3'
(R):5'- TTGCTCTGAGGGAATCACTGG -3'

Sequencing Primer
(F):5'- CGAAGCTCTGATGATGACAACTTG -3'
(R):5'- CACTGGAGACCATCTTTAGTAGG -3'
Posted On2019-12-04