Incidental Mutation 'RF063:Vmn1r74'
ID 605462
Institutional Source Beutler Lab
Gene Symbol Vmn1r74
Ensembl Gene ENSMUSG00000047655
Gene Name vomeronasal 1 receptor 74
Synonyms V1rg5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # RF063 (G1)
Quality Score 214.458
Status Not validated
Chromosome 7
Chromosomal Location 11833980-11853276 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CAGAGCCACCAAGTACCT to C at 11847140 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050416] [ENSMUST00000228471]
AlphaFold Q8R290
Predicted Effect probably null
Transcript: ENSMUST00000050416
SMART Domains Protein: ENSMUSP00000055148
Gene: ENSMUSG00000047655

Pfam:7tm_1 22 290 1.3e-7 PFAM
Pfam:V1R 34 296 1.2e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000228471
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G T 2: 25,447,397 E2421D probably damaging Het
Apc A AATAAAGCCC 18: 34,282,009 probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,141,256 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
F11r CCCCCCCCC CCCCCCCCCCC 1: 171,461,190 probably benign Het
Fam171b C CAGCAGA 2: 83,812,896 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTACGTGTGCTGGT 5: 110,378,139 probably benign Het
Fbrsl1 GTGCTGGTG GTGCTGGTGCGTCTGCTGGTG 5: 110,378,143 probably benign Het
Iqgap1 AGGCCACCACTGCTCACAGGTGCTGTACCT A 7: 80,723,751 probably null Het
Kmt2c GCT GCTCCT 5: 25,315,764 probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 29,021,443 probably null Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Med12l AGC AGCCGC 3: 59,275,973 probably benign Het
Sh3pxd2b TGTGCC TGTGCCCGTGCC 11: 32,423,051 probably benign Het
Sorcs2 ATACATACATACCT AT 5: 36,153,811 probably null Het
Sry TGCTGCTGCTGCTGCTG T Y: 2,662,595 probably null Het
Stard8 GAG GAGTAG X: 99,066,524 probably null Het
Thegl CCAG CCAGCGATCCTCCCCAGTCCCGCAAGGTCAG 5: 77,016,426 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGTTGCTGCT 15: 72,801,324 probably benign Het
Other mutations in Vmn1r74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Vmn1r74 APN 7 11847633 missense probably damaging 0.98
IGL01673:Vmn1r74 APN 7 11847390 missense possibly damaging 0.94
IGL03023:Vmn1r74 APN 7 11847330 missense possibly damaging 0.46
IGL03409:Vmn1r74 APN 7 11847313 missense probably damaging 0.99
R0393:Vmn1r74 UTSW 7 11847315 missense possibly damaging 0.79
R1488:Vmn1r74 UTSW 7 11847583 missense probably benign 0.02
R1707:Vmn1r74 UTSW 7 11847577 missense probably damaging 0.98
R1998:Vmn1r74 UTSW 7 11847375 missense probably damaging 1.00
R1999:Vmn1r74 UTSW 7 11847375 missense probably damaging 1.00
R2139:Vmn1r74 UTSW 7 11847316 missense probably damaging 1.00
R4027:Vmn1r74 UTSW 7 11846971 missense probably damaging 0.98
R4576:Vmn1r74 UTSW 7 11846769 splice site probably null
R4619:Vmn1r74 UTSW 7 11847471 missense possibly damaging 0.61
R4619:Vmn1r74 UTSW 7 11847476 missense probably damaging 1.00
R5371:Vmn1r74 UTSW 7 11847057 missense probably damaging 1.00
R5606:Vmn1r74 UTSW 7 11846895 missense probably benign 0.01
R6464:Vmn1r74 UTSW 7 11847204 missense possibly damaging 0.87
R6901:Vmn1r74 UTSW 7 11847441 missense probably benign 0.00
R6920:Vmn1r74 UTSW 7 11847648 missense probably benign 0.01
R7223:Vmn1r74 UTSW 7 11846967 nonsense probably null
R7231:Vmn1r74 UTSW 7 11846961 missense probably benign 0.34
R7418:Vmn1r74 UTSW 7 11847154 missense possibly damaging 0.88
R8135:Vmn1r74 UTSW 7 11847603 missense probably benign 0.36
R8692:Vmn1r74 UTSW 7 11847045 missense probably benign 0.03
R8748:Vmn1r74 UTSW 7 11846976 missense probably benign 0.10
R9004:Vmn1r74 UTSW 7 11846913 missense probably benign 0.00
R9258:Vmn1r74 UTSW 7 11847072 missense possibly damaging 0.86
RF049:Vmn1r74 UTSW 7 11847140 frame shift probably null
Z1176:Vmn1r74 UTSW 7 11847009 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04