Incidental Mutation 'RF063:Iqcf4'
ID605464
Institutional Source Beutler Lab
Gene Symbol Iqcf4
Ensembl Gene ENSMUSG00000041009
Gene NameIQ motif containing F4
Synonyms1700042N06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #RF063 (G1)
Quality Score116.467
Status Not validated
Chromosome9
Chromosomal Location106568319-106570996 bp(-) (GRCm38)
Type of Mutationsmall insertion (12 aa in frame mutation)
DNA Base Change (assembly) TCCTTTT to TCCTTTTCCTTTTCCTTGTCCTTTTCCTTTTCCTTTGCCTTTT at 106570617 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085111]
Predicted Effect probably benign
Transcript: ENSMUST00000085111
SMART Domains Protein: ENSMUSP00000082192
Gene: ENSMUSG00000041009

DomainStartEndE-ValueType
coiled coil region 14 41 N/A INTRINSIC
IQ 66 88 2.72e-3 SMART
IQ 89 111 2.32e2 SMART
IQ 122 144 9.33e-2 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik CAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,883 probably benign Het
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
Abca2 G T 2: 25,447,397 E2421D probably damaging Het
Apc A AATAAAGCCC 18: 34,282,009 probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,141,256 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
F11r CCCCCCCCC CCCCCCCCCCC 1: 171,461,190 probably benign Het
Fam171b C CAGCAGA 2: 83,812,896 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTACGTGTGCTGGT 5: 110,378,139 probably benign Het
Fbrsl1 GTGCTGGTG GTGCTGGTGCGTCTGCTGGTG 5: 110,378,143 probably benign Het
Iqgap1 AGGCCACCACTGCTCACAGGTGCTGTACCT A 7: 80,723,751 probably null Het
Kmt2c GCT GCTCCT 5: 25,315,764 probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 29,021,443 probably null Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Med12l AGC AGCCGC 3: 59,275,973 probably benign Het
Rassf6 C CTGCCTCACTCATGGTCCTGTAGAGCAATGGGGATTA 5: 90,608,942 probably null Het
Sh3pxd2b TGTGCC TGTGCCCGTGCC 11: 32,423,051 probably benign Het
Sorcs2 ATACATACATACCT AT 5: 36,153,811 probably null Het
Sry TGCTGCTGCTGCTGCTG T Y: 2,662,595 probably null Het
Stard8 GAG GAGTAG X: 99,066,524 probably null Het
Tcof1 GATCCCCTTGGC GATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGATATCCCCTTGGC 18: 60,833,573 probably benign Het
Thegl CCAG CCAGCGATCCTCCCCAGTCCCGCAAGGTCAG 5: 77,016,426 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGTTGCTGCT 15: 72,801,324 probably benign Het
Vmn1r74 CAGAGCCACCAAGTACCT C 7: 11,847,140 probably null Het
Other mutations in Iqcf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Iqcf4 APN 9 106570633 missense probably benign 0.12
R0781:Iqcf4 UTSW 9 106568661 missense probably benign 0.06
R1764:Iqcf4 UTSW 9 106568694 missense probably benign 0.12
R4525:Iqcf4 UTSW 9 106570628 missense possibly damaging 0.51
R4703:Iqcf4 UTSW 9 106568320 splice site probably null
R5823:Iqcf4 UTSW 9 106568601 missense probably benign 0.00
R6298:Iqcf4 UTSW 9 106568675 missense probably benign 0.25
R7773:Iqcf4 UTSW 9 106568613 missense probably benign 0.08
R7780:Iqcf4 UTSW 9 106568661 missense possibly damaging 0.93
R7818:Iqcf4 UTSW 9 106570539 nonsense probably null
RF003:Iqcf4 UTSW 9 106570607 small insertion probably benign
RF007:Iqcf4 UTSW 9 106570609 small insertion probably benign
RF016:Iqcf4 UTSW 9 106570609 small insertion probably benign
RF028:Iqcf4 UTSW 9 106570614 small insertion probably benign
RF031:Iqcf4 UTSW 9 106570615 small insertion probably benign
RF036:Iqcf4 UTSW 9 106570611 small insertion probably benign
RF041:Iqcf4 UTSW 9 106570613 nonsense probably null
RF042:Iqcf4 UTSW 9 106570605 small insertion probably benign
RF043:Iqcf4 UTSW 9 106570613 small insertion probably benign
RF045:Iqcf4 UTSW 9 106570610 small insertion probably benign
RF046:Iqcf4 UTSW 9 106570610 small insertion probably benign
RF047:Iqcf4 UTSW 9 106570612 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCTTGCTCACACAAGTC -3'
(R):5'- CAGAGATAAGTCCAGCATCTAGGG -3'

Sequencing Primer
(F):5'- GGTGCATACATTCCATGACCG -3'
(R):5'- GTCCAGCATCTAGGGATACTG -3'
Posted On2019-12-04