Incidental Mutation 'RF063:Lrtm1'
ID605467
Institutional Source Beutler Lab
Gene Symbol Lrtm1
Ensembl Gene ENSMUSG00000045776
Gene Nameleucine-rich repeats and transmembrane domains 1
SynonymsA930016D02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #RF063 (G1)
Quality Score214.458
Status Not validated
Chromosome14
Chromosomal Location29018208-29033645 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TAGCCTCAGTGGCC to T at 29021443 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000055662] [ENSMUST00000224708] [ENSMUST00000224760]
Predicted Effect probably benign
Transcript: ENSMUST00000022567
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055662
SMART Domains Protein: ENSMUSP00000061828
Gene: ENSMUSG00000045776

DomainStartEndE-ValueType
LRRNT 32 66 4.41e-6 SMART
LRR 65 84 2.33e2 SMART
LRR 85 108 2.67e-1 SMART
LRR 109 131 1.15e1 SMART
LRR_TYP 133 156 3.89e-3 SMART
LRRCT 192 245 8.63e-6 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224708
Predicted Effect probably benign
Transcript: ENSMUST00000224760
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik CAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,883 probably benign Het
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
Abca2 G T 2: 25,447,397 E2421D probably damaging Het
Apc A AATAAAGCCC 18: 34,282,009 probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,141,256 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
F11r CCCCCCCCC CCCCCCCCCCC 1: 171,461,190 probably benign Het
Fam171b C CAGCAGA 2: 83,812,896 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTACGTGTGCTGGT 5: 110,378,139 probably benign Het
Fbrsl1 GTGCTGGTG GTGCTGGTGCGTCTGCTGGTG 5: 110,378,143 probably benign Het
Iqcf4 TCCTTTT TCCTTTTCCTTTTCCTTGTCCTTTTCCTTTTCCTTTGCCTTTT 9: 106,570,617 probably benign Het
Iqgap1 AGGCCACCACTGCTCACAGGTGCTGTACCT A 7: 80,723,751 probably null Het
Kmt2c GCT GCTCCT 5: 25,315,764 probably benign Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Med12l AGC AGCCGC 3: 59,275,973 probably benign Het
Rassf6 C CTGCCTCACTCATGGTCCTGTAGAGCAATGGGGATTA 5: 90,608,942 probably null Het
Sh3pxd2b TGTGCC TGTGCCCGTGCC 11: 32,423,051 probably benign Het
Sorcs2 ATACATACATACCT AT 5: 36,153,811 probably null Het
Sry TGCTGCTGCTGCTGCTG T Y: 2,662,595 probably null Het
Stard8 GAG GAGTAG X: 99,066,524 probably null Het
Tcof1 GATCCCCTTGGC GATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGATATCCCCTTGGC 18: 60,833,573 probably benign Het
Thegl CCAG CCAGCGATCCTCCCCAGTCCCGCAAGGTCAG 5: 77,016,426 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGTTGCTGCT 15: 72,801,324 probably benign Het
Vmn1r74 CAGAGCCACCAAGTACCT C 7: 11,847,140 probably null Het
Other mutations in Lrtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Lrtm1 APN 14 29021949 missense probably benign 0.00
R0102:Lrtm1 UTSW 14 29022227 splice site probably benign
R0102:Lrtm1 UTSW 14 29022227 splice site probably benign
R0602:Lrtm1 UTSW 14 29022222 splice site probably benign
R5214:Lrtm1 UTSW 14 29021694 missense possibly damaging 0.58
R5253:Lrtm1 UTSW 14 29021844 missense probably benign 0.13
R5787:Lrtm1 UTSW 14 29021990 missense possibly damaging 0.89
R5937:Lrtm1 UTSW 14 29021830 missense possibly damaging 0.90
R6238:Lrtm1 UTSW 14 29027671 missense probably benign 0.02
R6850:Lrtm1 UTSW 14 29027450 missense probably benign 0.00
R7304:Lrtm1 UTSW 14 29022118 missense probably damaging 0.97
R7363:Lrtm1 UTSW 14 29021893 missense probably damaging 1.00
R7385:Lrtm1 UTSW 14 29027716 missense probably benign 0.00
R8181:Lrtm1 UTSW 14 29021937 missense probably damaging 1.00
RF036:Lrtm1 UTSW 14 29021443 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGAGAGGTCCTTTTAGAACTGTG -3'
(R):5'- ACATTTCATGGGGCAGCTG -3'

Sequencing Primer
(F):5'- CCTTTTAGAACTGTGGGCATCAGC -3'
(R):5'- GAGCAGGAGACCCACACTG -3'
Posted On2019-12-04