Incidental Mutation 'RF063:Tcof1'
ID 605471
Institutional Source Beutler Lab
Gene Symbol Tcof1
Ensembl Gene ENSMUSG00000024613
Gene Name treacle ribosome biogenesis factor 1
Synonyms treacle
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF063 (G1)
Quality Score 217.468
Status Not validated
Chromosome 18
Chromosomal Location 60946827-60982043 bp(-) (GRCm39)
Type of Mutation small insertion (12 aa in frame mutation)
DNA Base Change (assembly) GATCCCCTTGGC to GATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGATATCCCCTTGGC at 60966645 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]
AlphaFold O08784
Predicted Effect probably benign
Transcript: ENSMUST00000163446
SMART Domains Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 322 2.2e-8 PFAM
Pfam:Treacle 321 793 4.6e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 855 874 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 916 927 N/A INTRINSIC
low complexity region 967 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175934
SMART Domains Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 153 329 1.6e-12 PFAM
Pfam:Treacle 321 792 6.1e-175 PFAM
Pfam:Treacle 782 936 3.2e-16 PFAM
low complexity region 969 982 N/A INTRINSIC
low complexity region 1025 1039 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1149 1172 N/A INTRINSIC
low complexity region 1260 1285 N/A INTRINSIC
coiled coil region 1306 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176630
SMART Domains Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 323 2.5e-8 PFAM
Pfam:Treacle 321 793 5.9e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 843 857 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 933 946 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
coiled coil region 1270 1299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177172
SMART Domains Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 150 322 1.3e-10 PFAM
Pfam:Treacle 321 506 1.5e-78 PFAM
Pfam:Treacle 498 745 2e-105 PFAM
low complexity region 771 786 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
low complexity region 941 955 N/A INTRINSIC
low complexity region 976 990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik CAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,846 (GRCm39) probably benign Het
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,847 (GRCm39) probably benign Het
Abca2 G T 2: 25,337,409 (GRCm39) E2421D probably damaging Het
Apc A AATAAAGCCC 18: 34,415,062 (GRCm39) probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,129,695 (GRCm39) probably benign Het
Casz1 CACA C 4: 149,036,761 (GRCm39) probably benign Het
Dock4 GTGCCGGTGCCCGT G 12: 40,894,398 (GRCm39) probably null Het
F11r CCCCCCCCC CCCCCCCCCCC 1: 171,288,758 (GRCm39) probably benign Het
Fam171b C CAGCAGA 2: 83,643,240 (GRCm39) probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTACGTGTGCTGGT 5: 110,526,005 (GRCm39) probably benign Het
Fbrsl1 GTGCTGGTG GTGCTGGTGCGTCTGCTGGTG 5: 110,526,009 (GRCm39) probably benign Het
Iqcf4 TCCTTTT TCCTTTTCCTTTTCCTTGTCCTTTTCCTTTTCCTTTGCCTTTT 9: 106,447,816 (GRCm39) probably benign Het
Iqgap1 AGGCCACCACTGCTCACAGGTGCTGTACCT A 7: 80,373,499 (GRCm39) probably null Het
Kmt2c GCT GCTCCT 5: 25,520,762 (GRCm39) probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 28,743,400 (GRCm39) probably null Het
Med12l AACA AACAACA 3: 59,183,379 (GRCm39) probably benign Het
Med12l AGC AGCCGC 3: 59,183,394 (GRCm39) probably benign Het
Rassf6 C CTGCCTCACTCATGGTCCTGTAGAGCAATGGGGATTA 5: 90,756,801 (GRCm39) probably null Het
Sh3pxd2b TGTGCC TGTGCCCGTGCC 11: 32,373,051 (GRCm39) probably benign Het
Sorcs2 ATACATACATACCT AT 5: 36,311,155 (GRCm39) probably null Het
Spmap2l CCAG CCAGCGATCCTCCCCAGTCCCGCAAGGTCAG 5: 77,164,273 (GRCm39) probably benign Het
Sry TGCTGCTGCTGCTGCTG T Y: 2,662,595 (GRCm39) probably null Het
Stard8 GAG GAGTAG X: 98,110,130 (GRCm39) probably null Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,673,169 (GRCm39) probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGTTGCTGCT 15: 72,673,173 (GRCm39) probably benign Het
Vmn1r74 CAGAGCCACCAAGTACCT C 7: 11,581,067 (GRCm39) probably null Het
Other mutations in Tcof1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tcof1 APN 18 60,947,640 (GRCm39) unclassified probably benign
IGL01339:Tcof1 APN 18 60,951,167 (GRCm39) utr 3 prime probably benign
IGL02072:Tcof1 APN 18 60,964,637 (GRCm39) missense possibly damaging 0.85
IGL02160:Tcof1 APN 18 60,981,815 (GRCm39) unclassified probably benign
IGL02513:Tcof1 APN 18 60,964,850 (GRCm39) missense possibly damaging 0.51
IGL02823:Tcof1 APN 18 60,949,120 (GRCm39) missense probably benign 0.00
IGL03161:Tcof1 APN 18 60,966,560 (GRCm39) missense possibly damaging 0.86
IGL03291:Tcof1 APN 18 60,962,133 (GRCm39) missense possibly damaging 0.71
FR4304:Tcof1 UTSW 18 60,968,814 (GRCm39) unclassified probably benign
FR4589:Tcof1 UTSW 18 60,961,722 (GRCm39) critical splice donor site probably benign
FR4737:Tcof1 UTSW 18 60,961,722 (GRCm39) critical splice donor site probably benign
PIT4802001:Tcof1 UTSW 18 60,965,010 (GRCm39) missense unknown
R0569:Tcof1 UTSW 18 60,962,107 (GRCm39) missense possibly damaging 0.85
R0602:Tcof1 UTSW 18 60,966,605 (GRCm39) missense probably damaging 1.00
R0744:Tcof1 UTSW 18 60,978,904 (GRCm39) missense probably damaging 1.00
R0782:Tcof1 UTSW 18 60,949,352 (GRCm39) missense probably damaging 0.97
R0833:Tcof1 UTSW 18 60,978,904 (GRCm39) missense probably damaging 1.00
R0836:Tcof1 UTSW 18 60,978,904 (GRCm39) missense probably damaging 1.00
R0885:Tcof1 UTSW 18 60,968,922 (GRCm39) missense possibly damaging 0.84
R1465:Tcof1 UTSW 18 60,952,026 (GRCm39) splice site probably benign
R1528:Tcof1 UTSW 18 60,948,071 (GRCm39) nonsense probably null
R1643:Tcof1 UTSW 18 60,949,300 (GRCm39) missense possibly damaging 0.72
R1919:Tcof1 UTSW 18 60,949,156 (GRCm39) missense possibly damaging 0.85
R1920:Tcof1 UTSW 18 60,971,927 (GRCm39) missense possibly damaging 0.87
R1921:Tcof1 UTSW 18 60,971,927 (GRCm39) missense possibly damaging 0.87
R2023:Tcof1 UTSW 18 60,966,605 (GRCm39) missense probably damaging 1.00
R2108:Tcof1 UTSW 18 60,968,845 (GRCm39) missense probably damaging 0.97
R2114:Tcof1 UTSW 18 60,965,857 (GRCm39) missense possibly damaging 0.85
R2115:Tcof1 UTSW 18 60,965,857 (GRCm39) missense possibly damaging 0.85
R2116:Tcof1 UTSW 18 60,965,857 (GRCm39) missense possibly damaging 0.85
R2117:Tcof1 UTSW 18 60,965,857 (GRCm39) missense possibly damaging 0.85
R2156:Tcof1 UTSW 18 60,964,901 (GRCm39) missense possibly damaging 0.92
R2221:Tcof1 UTSW 18 60,970,973 (GRCm39) missense possibly damaging 0.51
R2229:Tcof1 UTSW 18 60,965,249 (GRCm39) intron probably benign
R2913:Tcof1 UTSW 18 60,949,156 (GRCm39) missense possibly damaging 0.85
R2914:Tcof1 UTSW 18 60,949,156 (GRCm39) missense possibly damaging 0.85
R3944:Tcof1 UTSW 18 60,955,909 (GRCm39) missense probably damaging 0.98
R3979:Tcof1 UTSW 18 60,964,605 (GRCm39) missense possibly damaging 0.71
R4049:Tcof1 UTSW 18 60,965,975 (GRCm39) missense possibly damaging 0.84
R4125:Tcof1 UTSW 18 60,952,673 (GRCm39) missense unknown
R5047:Tcof1 UTSW 18 60,964,986 (GRCm39) missense possibly damaging 0.86
R5433:Tcof1 UTSW 18 60,951,105 (GRCm39) utr 3 prime probably benign
R5546:Tcof1 UTSW 18 60,964,628 (GRCm39) missense possibly damaging 0.85
R5832:Tcof1 UTSW 18 60,952,611 (GRCm39) missense unknown
R5965:Tcof1 UTSW 18 60,966,490 (GRCm39) critical splice donor site probably null
R6301:Tcof1 UTSW 18 60,961,897 (GRCm39) missense probably damaging 0.97
R6480:Tcof1 UTSW 18 60,947,852 (GRCm39) splice site probably null
R6910:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R6911:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R7105:Tcof1 UTSW 18 60,976,368 (GRCm39) missense probably damaging 1.00
R7225:Tcof1 UTSW 18 60,961,520 (GRCm39) missense unknown
R7356:Tcof1 UTSW 18 60,951,166 (GRCm39) missense unknown
R7467:Tcof1 UTSW 18 60,964,977 (GRCm39) missense unknown
R7536:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R7804:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R7818:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R7863:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8006:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8007:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8008:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8063:Tcof1 UTSW 18 60,971,834 (GRCm39) missense probably damaging 1.00
R8192:Tcof1 UTSW 18 60,976,375 (GRCm39) missense probably damaging 1.00
R8200:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8203:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8204:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8207:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8217:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8300:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8517:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8518:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8553:Tcof1 UTSW 18 60,964,643 (GRCm39) missense possibly damaging 0.92
R8729:Tcof1 UTSW 18 60,962,145 (GRCm39) missense unknown
R8732:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8749:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R9800:Tcof1 UTSW 18 60,949,558 (GRCm39) missense unknown
RF001:Tcof1 UTSW 18 60,968,811 (GRCm39) unclassified probably benign
RF007:Tcof1 UTSW 18 60,966,640 (GRCm39) small insertion probably benign
RF009:Tcof1 UTSW 18 60,968,815 (GRCm39) unclassified probably benign
RF010:Tcof1 UTSW 18 60,968,816 (GRCm39) unclassified probably benign
RF011:Tcof1 UTSW 18 60,968,811 (GRCm39) unclassified probably benign
RF013:Tcof1 UTSW 18 60,968,815 (GRCm39) unclassified probably benign
RF015:Tcof1 UTSW 18 60,966,656 (GRCm39) small insertion probably benign
RF016:Tcof1 UTSW 18 60,966,647 (GRCm39) small insertion probably benign
RF022:Tcof1 UTSW 18 60,968,807 (GRCm39) unclassified probably benign
RF024:Tcof1 UTSW 18 60,968,810 (GRCm39) unclassified probably benign
RF027:Tcof1 UTSW 18 60,968,808 (GRCm39) unclassified probably benign
RF029:Tcof1 UTSW 18 60,968,817 (GRCm39) unclassified probably benign
RF029:Tcof1 UTSW 18 60,968,807 (GRCm39) unclassified probably benign
RF030:Tcof1 UTSW 18 60,968,795 (GRCm39) unclassified probably benign
RF030:Tcof1 UTSW 18 60,966,646 (GRCm39) small insertion probably benign
RF030:Tcof1 UTSW 18 60,966,640 (GRCm39) small insertion probably benign
RF031:Tcof1 UTSW 18 60,968,817 (GRCm39) unclassified probably benign
RF031:Tcof1 UTSW 18 60,966,637 (GRCm39) small insertion probably benign
RF035:Tcof1 UTSW 18 60,966,625 (GRCm39) small insertion probably benign
RF036:Tcof1 UTSW 18 60,968,808 (GRCm39) unclassified probably benign
RF036:Tcof1 UTSW 18 60,961,480 (GRCm39) small insertion probably benign
RF038:Tcof1 UTSW 18 60,966,638 (GRCm39) small insertion probably benign
RF040:Tcof1 UTSW 18 60,966,655 (GRCm39) small insertion probably benign
RF040:Tcof1 UTSW 18 60,961,480 (GRCm39) small insertion probably benign
RF041:Tcof1 UTSW 18 60,966,648 (GRCm39) small insertion probably benign
RF041:Tcof1 UTSW 18 60,966,644 (GRCm39) small insertion probably benign
RF043:Tcof1 UTSW 18 60,966,644 (GRCm39) small insertion probably benign
RF050:Tcof1 UTSW 18 60,966,651 (GRCm39) small insertion probably benign
RF051:Tcof1 UTSW 18 60,966,651 (GRCm39) small insertion probably benign
RF053:Tcof1 UTSW 18 60,968,819 (GRCm39) unclassified probably benign
RF056:Tcof1 UTSW 18 60,966,647 (GRCm39) small insertion probably benign
RF057:Tcof1 UTSW 18 60,966,638 (GRCm39) small insertion probably benign
RF057:Tcof1 UTSW 18 60,966,637 (GRCm39) small insertion probably benign
RF057:Tcof1 UTSW 18 60,966,636 (GRCm39) small insertion probably benign
RF057:Tcof1 UTSW 18 60,966,643 (GRCm39) small insertion probably benign
RF060:Tcof1 UTSW 18 60,968,816 (GRCm39) unclassified probably benign
RF060:Tcof1 UTSW 18 60,968,819 (GRCm39) unclassified probably benign
RF064:Tcof1 UTSW 18 60,966,646 (GRCm39) small insertion probably benign
RF064:Tcof1 UTSW 18 60,966,643 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTTCAGGTCTGGGCTATAATGC -3'
(R):5'- CCACTATATGGTGTCACTGGG -3'

Sequencing Primer
(F):5'- GCTATAATGCCTCCCTTCTCC -3'
(R):5'- TGAGGAGGTCAGTGCTCAG -3'
Posted On 2019-12-04