Incidental Mutation 'RF063:Calhm1'
ID605472
Institutional Source Beutler Lab
Gene Symbol Calhm1
Ensembl Gene ENSMUSG00000079258
Gene Namecalcium homeostasis modulator 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF063 (G1)
Quality Score217.471
Status Not validated
Chromosome19
Chromosomal Location47141035-47144174 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TGGCTGTGGCTG to TGGCTGTGGCTGCGGCTGTGGCTG at 47141256 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035822] [ENSMUST00000111813] [ENSMUST00000140512]
Predicted Effect probably benign
Transcript: ENSMUST00000035822
SMART Domains Protein: ENSMUSP00000047278
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 256 2.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111813
SMART Domains Protein: ENSMUSP00000107444
Gene: ENSMUSG00000079258

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 1 255 5.6e-94 PFAM
low complexity region 267 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium channel that plays a role in processing of amyloid-beta precursor protein. A polymorphism at this locus has been reported to be associated with susceptibility to late-onset Alzheimer's disease in some populations, but the pathogenicity of this polymorphism is unclear.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cortical neuron electrical properties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik CAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,883 probably benign Het
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
Abca2 G T 2: 25,447,397 E2421D probably damaging Het
Apc A AATAAAGCCC 18: 34,282,009 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
F11r CCCCCCCCC CCCCCCCCCCC 1: 171,461,190 probably benign Het
Fam171b C CAGCAGA 2: 83,812,896 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTACGTGTGCTGGT 5: 110,378,139 probably benign Het
Fbrsl1 GTGCTGGTG GTGCTGGTGCGTCTGCTGGTG 5: 110,378,143 probably benign Het
Iqcf4 TCCTTTT TCCTTTTCCTTTTCCTTGTCCTTTTCCTTTTCCTTTGCCTTTT 9: 106,570,617 probably benign Het
Iqgap1 AGGCCACCACTGCTCACAGGTGCTGTACCT A 7: 80,723,751 probably null Het
Kmt2c GCT GCTCCT 5: 25,315,764 probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 29,021,443 probably null Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Med12l AGC AGCCGC 3: 59,275,973 probably benign Het
Rassf6 C CTGCCTCACTCATGGTCCTGTAGAGCAATGGGGATTA 5: 90,608,942 probably null Het
Sh3pxd2b TGTGCC TGTGCCCGTGCC 11: 32,423,051 probably benign Het
Sorcs2 ATACATACATACCT AT 5: 36,153,811 probably null Het
Sry TGCTGCTGCTGCTGCTG T Y: 2,662,595 probably null Het
Stard8 GAG GAGTAG X: 99,066,524 probably null Het
Tcof1 GATCCCCTTGGC GATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGATATCCCCTTGGC 18: 60,833,573 probably benign Het
Thegl CCAG CCAGCGATCCTCCCCAGTCCCGCAAGGTCAG 5: 77,016,426 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGTTGCTGCT 15: 72,801,324 probably benign Het
Vmn1r74 CAGAGCCACCAAGTACCT C 7: 11,847,140 probably null Het
Other mutations in Calhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Calhm1 UTSW 19 47141251 unclassified probably benign
FR4449:Calhm1 UTSW 19 47141274 unclassified probably benign
FR4976:Calhm1 UTSW 19 47141262 unclassified probably benign
R0328:Calhm1 UTSW 19 47141303 missense possibly damaging 0.46
R0402:Calhm1 UTSW 19 47141457 missense probably damaging 0.98
R0463:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R0608:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R1552:Calhm1 UTSW 19 47141201 missense probably benign 0.00
R4647:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R4648:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R5762:Calhm1 UTSW 19 47143619 splice site probably null
R5766:Calhm1 UTSW 19 47143703 missense probably benign 0.00
RF001:Calhm1 UTSW 19 47141276 unclassified probably benign
RF010:Calhm1 UTSW 19 47141273 unclassified probably benign
RF014:Calhm1 UTSW 19 47141265 unclassified probably benign
RF015:Calhm1 UTSW 19 47141256 unclassified probably benign
RF023:Calhm1 UTSW 19 47141273 unclassified probably benign
RF025:Calhm1 UTSW 19 47141276 unclassified probably benign
RF025:Calhm1 UTSW 19 47141277 unclassified probably benign
RF030:Calhm1 UTSW 19 47141253 unclassified probably benign
RF032:Calhm1 UTSW 19 47141283 frame shift probably null
RF035:Calhm1 UTSW 19 47141253 unclassified probably benign
RF036:Calhm1 UTSW 19 47141277 unclassified probably benign
RF040:Calhm1 UTSW 19 47141277 unclassified probably benign
RF050:Calhm1 UTSW 19 47141270 unclassified probably benign
RF057:Calhm1 UTSW 19 47141270 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACACTTTGCTGAAGTAGGTGG -3'
(R):5'- AGCAAGTACTGGTCCCACTAC -3'

Sequencing Primer
(F):5'- AAGTAGGTGGCCACTTCCTTGC -3'
(R):5'- GGTCCCACTACATTGACATTGAG -3'
Posted On2019-12-04