Incidental Mutation 'RF064:Il2'
ID 605477
Institutional Source Beutler Lab
Gene Symbol Il2
Ensembl Gene ENSMUSG00000027720
Gene Name interleukin 2
Synonyms IL-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF064 (G1)
Quality Score 217.468
Status Not validated
Chromosome 3
Chromosomal Location 37174862-37180103 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG to AGCTGCTGCTGCTGCTGCTGCTGCTG at 37179913 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029275]
AlphaFold P04351
Predicted Effect probably benign
Transcript: ENSMUST00000029275
SMART Domains Protein: ENSMUSP00000029275
Gene: ENSMUSG00000027720

DomainStartEndE-ValueType
IL2 1 168 4.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

DomainStartEndE-ValueType
Pfam:A_deamin 1 176 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants develop adult onset autoimmune disease, with 50% mortality by 9 weeks due to hemolytic anemia. Survivors develop inflammatory bowl disease/colitis. Immune system dysregulation and CD4+ T-cell overproduction may be responsible. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G T 2: 25,337,409 (GRCm39) E2421D probably damaging Het
Acap3 GGCTGCTG GGCTGCTGCATCCTGCGCTGCTG 4: 155,989,557 (GRCm39) probably benign Het
Blm CCTCCTCCTCC CCTCCTCCTCCTACTCCTCCTCC 7: 80,162,671 (GRCm39) probably null Het
Ccdc170 CAC CACAAC 10: 4,511,025 (GRCm39) probably benign Het
Cgref1 ATTT ATTTTTT 5: 31,091,118 (GRCm39) probably benign Het
Efhd2 GCCGCC GCCGCCACCGCC 4: 141,602,066 (GRCm39) probably benign Het
Fbrsl1 GTGCTGGTGCGT GTGCTGGTGCGTCTGCTGGTGCGT 5: 110,525,997 (GRCm39) probably benign Het
Gabre CAGGCT C X: 71,313,777 (GRCm39) probably null Het
Gabre C CCGGCTA X: 71,313,669 (GRCm39) probably null Het
Gucy2d GG GGCGGTCCTGG 7: 98,108,250 (GRCm39) probably benign Het
Klra2 AAAGAAATCCA AAAGAAATCCAAAGAAATCCA 6: 131,198,802 (GRCm39) probably null Het
Krtap28-10 CCACAG CCACAGGCACAG 1: 83,019,852 (GRCm39) probably benign Het
Phc1 CTTGCTG CTTGCTGTTGCTG 6: 122,300,539 (GRCm39) probably benign Het
Polr1has CCACCACCACC CCACCACCACCCCCACCACCCACACCACCACC 17: 37,275,942 (GRCm39) probably benign Het
Spmap2l GTCCCGCAAGGCCAG GTCCCGCAAGGCCAGCGATCCTCCCCACTCCCGCAAGGCCAG 5: 77,164,262 (GRCm39) probably benign Het
Stard8 GA GAGTA X: 98,110,133 (GRCm39) probably null Het
Sympk CCCCACCCCTAGC CC 7: 18,768,320 (GRCm39) probably null Het
Tcof1 GAGATCCCCTTGGC GAGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAAAGATCCCCTTGGC 18: 60,966,643 (GRCm39) probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGC 18: 60,966,646 (GRCm39) probably benign Het
Trim33 CCCCGGCCC CCCC 3: 103,187,511 (GRCm39) probably null Het
Zfp598 CCACCA CCACCAACACCA 17: 24,899,757 (GRCm39) probably benign Het
Other mutations in Il2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Il2 APN 3 37,177,156 (GRCm39) missense possibly damaging 0.64
IGL02047:Il2 APN 3 37,180,000 (GRCm39) missense probably benign 0.01
FR4304:Il2 UTSW 3 37,179,975 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,977 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
FR4976:Il2 UTSW 3 37,179,978 (GRCm39) unclassified probably benign
R8805:Il2 UTSW 3 37,177,282 (GRCm39) missense possibly damaging 0.78
R9287:Il2 UTSW 3 37,179,988 (GRCm39) missense probably damaging 0.99
RF001:Il2 UTSW 3 37,179,911 (GRCm39) unclassified probably benign
RF023:Il2 UTSW 3 37,179,969 (GRCm39) unclassified probably benign
RF029:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
RF036:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF038:Il2 UTSW 3 37,179,970 (GRCm39) nonsense probably null
RF039:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF041:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF043:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF051:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,966 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,970 (GRCm39) unclassified probably benign
RF061:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGAAGGTGAGCATCCTGGG -3'
(R):5'- TTGCCTCCCATGCTGAAGAG -3'

Sequencing Primer
(F):5'- AGCATCCTGGGGAGTTTCAG -3'
(R):5'- ATGCTGAAGAGCTGCCTATC -3'
Posted On 2019-12-04