Incidental Mutation 'RF064:Klra2'
ID605485
Institutional Source Beutler Lab
Gene Symbol Klra2
Ensembl Gene ENSMUSG00000030187
Gene Namekiller cell lectin-like receptor, subfamily A, member 2
SynonymsLy49b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #RF064 (G1)
Quality Score214.458
Status Not validated
Chromosome6
Chromosomal Location131219223-131247362 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AAAGAAATCCA to AAAGAAATCCAAAGAAATCCA at 131221839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000086252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032306] [ENSMUST00000088867]
Predicted Effect probably benign
Transcript: ENSMUST00000032306
SMART Domains Protein: ENSMUSP00000032306
Gene: ENSMUSG00000030187

DomainStartEndE-ValueType
CLECT 137 260 1.17e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000088867
SMART Domains Protein: ENSMUSP00000086252
Gene: ENSMUSG00000030187

DomainStartEndE-ValueType
CLECT 137 293 6.54e-6 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: The gene is a member of the large lectin-like type 2 transmembrane receptor family of the natural killer gene complex. The gene is located distantly telomeric to its family's gene cluster on chromosome 6. The gene differs from the other genes in its cluster as its promoter region contains long and short interspersed repetitive elements suggesting a possible rearrangement or gene conversion. It is unknown whether this gene's encoded protein is involved with natural killer cell differentiation as are its other family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G T 2: 25,447,397 E2421D probably damaging Het
Acap3 GGCTGCTG GGCTGCTGCATCCTGCGCTGCTG 4: 155,905,100 probably benign Het
Blm CCTCCTCCTCC CCTCCTCCTCCTACTCCTCCTCC 7: 80,512,923 probably null Het
Ccdc170 CAC CACAAC 10: 4,561,025 probably benign Het
Cgref1 ATTT ATTTTTT 5: 30,933,774 probably benign Het
Efhd2 GCCGCC GCCGCCACCGCC 4: 141,874,755 probably benign Het
Fbrsl1 GTGCTGGTGCGT GTGCTGGTGCGTCTGCTGGTGCGT 5: 110,378,131 probably benign Het
Gabre C CCGGCTA X: 72,270,063 probably null Het
Gabre CAGGCT C X: 72,270,171 probably null Het
Gucy2d GG GGCGGTCCTGG 7: 98,459,043 probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,125,764 probably benign Het
Krtap28-10 CCACAG CCACAGGCACAG 1: 83,042,131 probably benign Het
Phc1 CTTGCTG CTTGCTGTTGCTG 6: 122,323,580 probably benign Het
Stard8 GA GAGTA X: 99,066,527 probably null Het
Sympk CCCCACCCCTAGC CC 7: 19,034,395 probably null Het
Tcof1 GAGATCCCCTTGGC GAGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAAAGATCCCCTTGGC 18: 60,833,571 probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGC 18: 60,833,574 probably benign Het
Thegl GTCCCGCAAGGCCAG GTCCCGCAAGGCCAGCGATCCTCCCCACTCCCGCAAGGCCAG 5: 77,016,415 probably benign Het
Trim33 CCCCGGCCC CCCC 3: 103,280,195 probably null Het
Zfp598 CCACCA CCACCAACACCA 17: 24,680,783 probably benign Het
Znrd1as CCACCACCACC CCACCACCACCCCCACCACCCACACCACCACC 17: 36,965,050 probably benign Het
Other mutations in Klra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Klra2 APN 6 131230217 missense probably benign 0.11
IGL02280:Klra2 APN 6 131245293 missense probably damaging 1.00
IGL02503:Klra2 APN 6 131230094 missense probably benign 0.10
IGL03120:Klra2 APN 6 131220217 missense probably benign 0.00
FR4449:Klra2 UTSW 6 131221846 frame shift probably null
FR4548:Klra2 UTSW 6 131221851 frame shift probably null
FR4737:Klra2 UTSW 6 131221852 frame shift probably null
R0082:Klra2 UTSW 6 131220247 missense possibly damaging 0.90
R0597:Klra2 UTSW 6 131220185 missense probably benign 0.00
R0606:Klra2 UTSW 6 131220224 missense probably damaging 1.00
R0636:Klra2 UTSW 6 131220104 splice site probably benign
R0800:Klra2 UTSW 6 131230174 nonsense probably null
R1645:Klra2 UTSW 6 131243894 critical splice donor site probably null
R1655:Klra2 UTSW 6 131220211 missense probably damaging 0.96
R1950:Klra2 UTSW 6 131230115 missense probably benign 0.02
R2088:Klra2 UTSW 6 131242826 missense probably damaging 0.99
R2402:Klra2 UTSW 6 131243901 missense probably benign 0.01
R3776:Klra2 UTSW 6 131242963 missense probably benign 0.06
R4131:Klra2 UTSW 6 131228217 missense probably benign 0.03
R4570:Klra2 UTSW 6 131243937 missense probably damaging 1.00
R4585:Klra2 UTSW 6 131230157 missense probably benign 0.11
R4586:Klra2 UTSW 6 131230157 missense probably benign 0.11
R4884:Klra2 UTSW 6 131230202 missense probably damaging 1.00
R4982:Klra2 UTSW 6 131220189 missense probably benign 0.25
R5043:Klra2 UTSW 6 131220172 missense probably benign 0.06
R5457:Klra2 UTSW 6 131221889 missense possibly damaging 0.92
R6526:Klra2 UTSW 6 131221876 missense probably benign 0.21
R6538:Klra2 UTSW 6 131242990 missense probably damaging 0.99
R7393:Klra2 UTSW 6 131230202 missense probably damaging 1.00
R7785:Klra2 UTSW 6 131245290 missense possibly damaging 0.95
RF020:Klra2 UTSW 6 131221838 frame shift probably null
RF059:Klra2 UTSW 6 131221838 frame shift probably null
Z1088:Klra2 UTSW 6 131228290 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAACATGTCAGACAGCC -3'
(R):5'- GGTTAATGTGTATTCTCATTACCACTG -3'

Sequencing Primer
(F):5'- CAGCCATTGTCTTAATAGCCAGG -3'
(R):5'- GTGTATTCTCATTACCACTGTATCC -3'
Posted On2019-12-04