Incidental Mutation 'RF064:Sympk'
ID605486
Institutional Source Beutler Lab
Gene Symbol Sympk
Ensembl Gene ENSMUSG00000023118
Gene Namesymplekin
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #RF064 (G1)
Quality Score214.566
Status Not validated
Chromosome7
Chromosomal Location19024377-19054618 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CCCCACCCCTAGC to CC at 19034395 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000146903] [ENSMUST00000153976]
Predicted Effect probably null
Transcript: ENSMUST00000023882
SMART Domains Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
low complexity region 106 118 N/A INTRINSIC
Pfam:DUF3453 119 352 1.1e-63 PFAM
low complexity region 473 485 N/A INTRINSIC
Pfam:Symplekin_C 887 1068 4.3e-78 PFAM
low complexity region 1123 1149 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000146903
SMART Domains Protein: ENSMUSP00000138740
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:DUF3453 117 230 1.1e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000153976
SMART Domains Protein: ENSMUSP00000121540
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:Cohesin_HEAT 48 96 9e-7 PFAM
Pfam:DUF3453 117 198 2.2e-24 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that functions in the regulation of polyadenylation and promotes gene expression. The protein forms a high-molecular weight complex with components of the polyadenylation machinery. It is thought to serve as a scaffold for recruiting regulatory factors to the polyadenylation complex. It also participates in 3'-end maturation of histone mRNAs, which do not undergo polyadenylation. The protein also localizes to the cytoplasmic plaques of tight junctions in some cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous ofr a transgenic gene disruption exhibit anemia at E15 and hydrops fetalis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G T 2: 25,447,397 E2421D probably damaging Het
Acap3 GGCTGCTG GGCTGCTGCATCCTGCGCTGCTG 4: 155,905,100 probably benign Het
Blm CCTCCTCCTCC CCTCCTCCTCCTACTCCTCCTCC 7: 80,512,923 probably null Het
Ccdc170 CAC CACAAC 10: 4,561,025 probably benign Het
Cgref1 ATTT ATTTTTT 5: 30,933,774 probably benign Het
Efhd2 GCCGCC GCCGCCACCGCC 4: 141,874,755 probably benign Het
Fbrsl1 GTGCTGGTGCGT GTGCTGGTGCGTCTGCTGGTGCGT 5: 110,378,131 probably benign Het
Gabre C CCGGCTA X: 72,270,063 probably null Het
Gabre CAGGCT C X: 72,270,171 probably null Het
Gucy2d GG GGCGGTCCTGG 7: 98,459,043 probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,125,764 probably benign Het
Klra2 AAAGAAATCCA AAAGAAATCCAAAGAAATCCA 6: 131,221,839 probably null Het
Krtap28-10 CCACAG CCACAGGCACAG 1: 83,042,131 probably benign Het
Phc1 CTTGCTG CTTGCTGTTGCTG 6: 122,323,580 probably benign Het
Stard8 GA GAGTA X: 99,066,527 probably null Het
Tcof1 GAGATCCCCTTGGC GAGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAAAGATCCCCTTGGC 18: 60,833,571 probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGC 18: 60,833,574 probably benign Het
Thegl GTCCCGCAAGGCCAG GTCCCGCAAGGCCAGCGATCCTCCCCACTCCCGCAAGGCCAG 5: 77,016,415 probably benign Het
Trim33 CCCCGGCCC CCCC 3: 103,280,195 probably null Het
Zfp598 CCACCA CCACCAACACCA 17: 24,680,783 probably benign Het
Znrd1as CCACCACCACC CCACCACCACCCCCACCACCCACACCACCACC 17: 36,965,050 probably benign Het
Other mutations in Sympk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Sympk APN 7 19047573 missense probably benign 0.14
IGL01834:Sympk APN 7 19043435 missense probably benign 0.02
IGL02588:Sympk APN 7 19042625 missense probably benign
IGL02601:Sympk APN 7 19048869 missense probably benign 0.31
IGL02645:Sympk APN 7 19052424 missense probably damaging 0.99
IGL02698:Sympk APN 7 19045634 missense probably benign 0.35
IGL02709:Sympk APN 7 19047538 missense probably benign 0.26
IGL02814:Sympk APN 7 19053273 missense probably damaging 1.00
IGL03198:Sympk APN 7 19044996 missense possibly damaging 0.92
butterfinger UTSW 7 19048453 missense probably damaging 0.98
fifth_avenue UTSW 7 19043460 missense possibly damaging 0.83
IGL02991:Sympk UTSW 7 19030577 missense probably damaging 1.00
R0391:Sympk UTSW 7 19046849 missense probably benign 0.06
R1036:Sympk UTSW 7 19048453 missense probably damaging 0.98
R1872:Sympk UTSW 7 19029145 missense probably benign
R2058:Sympk UTSW 7 19043529 missense probably damaging 1.00
R2103:Sympk UTSW 7 19054116 missense probably benign
R2966:Sympk UTSW 7 19030544 missense probably damaging 1.00
R3110:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3112:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3703:Sympk UTSW 7 19040561 missense probably damaging 0.99
R3775:Sympk UTSW 7 19035955 missense probably damaging 1.00
R3930:Sympk UTSW 7 19047522 missense possibly damaging 0.90
R4638:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4639:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4645:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4688:Sympk UTSW 7 19054410 missense probably benign
R5050:Sympk UTSW 7 19036042 missense probably benign 0.19
R5051:Sympk UTSW 7 19036042 missense probably benign 0.19
R5052:Sympk UTSW 7 19036042 missense probably benign 0.19
R5092:Sympk UTSW 7 19042659 missense probably benign 0.17
R5211:Sympk UTSW 7 19035889 missense probably benign 0.22
R5591:Sympk UTSW 7 19054039 missense probably damaging 1.00
R5678:Sympk UTSW 7 19049472 critical splice donor site probably null
R5972:Sympk UTSW 7 19046824 missense probably benign
R6387:Sympk UTSW 7 19052498 missense possibly damaging 0.94
R6543:Sympk UTSW 7 19036830 missense probably damaging 1.00
R6984:Sympk UTSW 7 19038043 missense probably benign 0.00
R7141:Sympk UTSW 7 19054092 missense probably benign
R7292:Sympk UTSW 7 19036030 missense probably benign 0.01
R7319:Sympk UTSW 7 19035845 missense probably benign
R7887:Sympk UTSW 7 19034439 missense possibly damaging 0.69
R8094:Sympk UTSW 7 19053448 critical splice donor site probably null
R8147:Sympk UTSW 7 19036793 missense probably damaging 0.98
X0017:Sympk UTSW 7 19040663 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GTCACACTCTGATAGTCGCC -3'
(R):5'- CTCTGATGTGGCTTTAACTGC -3'

Sequencing Primer
(F):5'- CTGTCACTCATGTAGATGGTACCAG -3'
(R):5'- AACTGCTTTTGGAAGGCCC -3'
Posted On2019-12-04