Incidental Mutation 'RF064:Znrd1as'
ID605491
Institutional Source Beutler Lab
Gene Symbol Znrd1as
Ensembl Gene ENSMUSG00000036214
Gene Namezinc ribbon domain containing 1, antisense
Synonyms1700022C21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #RF064 (G1)
Quality Score217.468
Status Not validated
Chromosome17
Chromosomal Location36958592-36965625 bp(+) (GRCm38)
Type of Mutationsmall insertion (7 aa in frame mutation)
DNA Base Change (assembly) CCACCACCACC to CCACCACCACCCCCACCACCCACACCACCACC at 36965050 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040177] [ENSMUST00000173814] [ENSMUST00000209623]
Predicted Effect probably benign
Transcript: ENSMUST00000040177
SMART Domains Protein: ENSMUSP00000048695
Gene: ENSMUSG00000036214

DomainStartEndE-ValueType
low complexity region 98 115 N/A INTRINSIC
coiled coil region 163 195 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173814
SMART Domains Protein: ENSMUSP00000134016
Gene: ENSMUSG00000036214

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
coiled coil region 84 116 N/A INTRINSIC
low complexity region 145 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209623
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G T 2: 25,447,397 E2421D probably damaging Het
Acap3 GGCTGCTG GGCTGCTGCATCCTGCGCTGCTG 4: 155,905,100 probably benign Het
Blm CCTCCTCCTCC CCTCCTCCTCCTACTCCTCCTCC 7: 80,512,923 probably null Het
Ccdc170 CAC CACAAC 10: 4,561,025 probably benign Het
Cgref1 ATTT ATTTTTT 5: 30,933,774 probably benign Het
Efhd2 GCCGCC GCCGCCACCGCC 4: 141,874,755 probably benign Het
Fbrsl1 GTGCTGGTGCGT GTGCTGGTGCGTCTGCTGGTGCGT 5: 110,378,131 probably benign Het
Gabre C CCGGCTA X: 72,270,063 probably null Het
Gabre CAGGCT C X: 72,270,171 probably null Het
Gucy2d GG GGCGGTCCTGG 7: 98,459,043 probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,125,764 probably benign Het
Klra2 AAAGAAATCCA AAAGAAATCCAAAGAAATCCA 6: 131,221,839 probably null Het
Krtap28-10 CCACAG CCACAGGCACAG 1: 83,042,131 probably benign Het
Phc1 CTTGCTG CTTGCTGTTGCTG 6: 122,323,580 probably benign Het
Stard8 GA GAGTA X: 99,066,527 probably null Het
Sympk CCCCACCCCTAGC CC 7: 19,034,395 probably null Het
Tcof1 GAGATCCCCTTGGC GAGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAAAGATCCCCTTGGC 18: 60,833,571 probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGC 18: 60,833,574 probably benign Het
Thegl GTCCCGCAAGGCCAG GTCCCGCAAGGCCAGCGATCCTCCCCACTCCCGCAAGGCCAG 5: 77,016,415 probably benign Het
Trim33 CCCCGGCCC CCCC 3: 103,280,195 probably null Het
Zfp598 CCACCA CCACCAACACCA 17: 24,680,783 probably benign Het
Other mutations in Znrd1as
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Znrd1as APN 17 36964921 missense probably damaging 0.99
R0347:Znrd1as UTSW 17 36965315 missense probably damaging 1.00
R0789:Znrd1as UTSW 17 36964960 missense probably damaging 1.00
R0993:Znrd1as UTSW 17 36965047 small deletion probably benign
R2110:Znrd1as UTSW 17 36965444 missense possibly damaging 0.47
R2866:Znrd1as UTSW 17 36965160 missense possibly damaging 0.91
R4224:Znrd1as UTSW 17 36958725 utr 5 prime probably benign
R4746:Znrd1as UTSW 17 36964873 missense probably benign 0.00
R7449:Znrd1as UTSW 17 36964383 missense probably damaging 1.00
RF005:Znrd1as UTSW 17 36965048 small insertion probably benign
RF008:Znrd1as UTSW 17 36965054 small insertion probably benign
RF010:Znrd1as UTSW 17 36965063 small insertion probably benign
RF014:Znrd1as UTSW 17 36965060 small insertion probably benign
RF024:Znrd1as UTSW 17 36965057 small insertion probably benign
RF025:Znrd1as UTSW 17 36965048 small insertion probably benign
RF029:Znrd1as UTSW 17 36965071 small insertion probably benign
RF035:Znrd1as UTSW 17 36965066 small insertion probably benign
RF046:Znrd1as UTSW 17 36965057 small insertion probably benign
RF048:Znrd1as UTSW 17 36965059 small insertion probably benign
RF053:Znrd1as UTSW 17 36965066 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGTGTGCATACAACAGCAGC -3'
(R):5'- GTGGGATGCTTTCCTCCTCTAG -3'

Sequencing Primer
(F):5'- CTTGATAACTCAGAAATGCCATGAGG -3'
(R):5'- TCCTCTAGCACAATTTTGGGTAG -3'
Posted On2019-12-04