Incidental Mutation 'RF064:Stard8'
ID605496
Institutional Source Beutler Lab
Gene Symbol Stard8
Ensembl Gene ENSMUSG00000031216
Gene NameSTART domain containing 8
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF064 (G1)
Quality Score204.468
Status Not validated
ChromosomeX
Chromosomal Location99003248-99074728 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) GA to GAGTA at 99066527 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036606] [ENSMUST00000149999]
Predicted Effect probably null
Transcript: ENSMUST00000036606
SMART Domains Protein: ENSMUSP00000044491
Gene: ENSMUSG00000031216

DomainStartEndE-ValueType
low complexity region 44 65 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 288 299 N/A INTRINSIC
coiled coil region 334 372 N/A INTRINSIC
low complexity region 396 417 N/A INTRINSIC
low complexity region 457 464 N/A INTRINSIC
RhoGAP 579 770 1.97e-56 SMART
START 814 1016 2.13e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149999
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of Rho GTPase activating proteins that contain a steroidogenic acute regulatory protein related lipid transfer domain. The encoded protein localizes to focal adhesions and may be involved in regulating cell morphology. This protein may also function as a tumor suppressor. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G T 2: 25,447,397 E2421D probably damaging Het
Acap3 GGCTGCTG GGCTGCTGCATCCTGCGCTGCTG 4: 155,905,100 probably benign Het
Blm CCTCCTCCTCC CCTCCTCCTCCTACTCCTCCTCC 7: 80,512,923 probably null Het
Ccdc170 CAC CACAAC 10: 4,561,025 probably benign Het
Cgref1 ATTT ATTTTTT 5: 30,933,774 probably benign Het
Efhd2 GCCGCC GCCGCCACCGCC 4: 141,874,755 probably benign Het
Fbrsl1 GTGCTGGTGCGT GTGCTGGTGCGTCTGCTGGTGCGT 5: 110,378,131 probably benign Het
Gabre C CCGGCTA X: 72,270,063 probably null Het
Gabre CAGGCT C X: 72,270,171 probably null Het
Gucy2d GG GGCGGTCCTGG 7: 98,459,043 probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,125,764 probably benign Het
Klra2 AAAGAAATCCA AAAGAAATCCAAAGAAATCCA 6: 131,221,839 probably null Het
Krtap28-10 CCACAG CCACAGGCACAG 1: 83,042,131 probably benign Het
Phc1 CTTGCTG CTTGCTGTTGCTG 6: 122,323,580 probably benign Het
Sympk CCCCACCCCTAGC CC 7: 19,034,395 probably null Het
Tcof1 GAGATCCCCTTGGC GAGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAAAGATCCCCTTGGC 18: 60,833,571 probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGC 18: 60,833,574 probably benign Het
Thegl GTCCCGCAAGGCCAG GTCCCGCAAGGCCAGCGATCCTCCCCACTCCCGCAAGGCCAG 5: 77,016,415 probably benign Het
Trim33 CCCCGGCCC CCCC 3: 103,280,195 probably null Het
Zfp598 CCACCA CCACCAACACCA 17: 24,680,783 probably benign Het
Znrd1as CCACCACCACC CCACCACCACCCCCACCACCCACACCACCACC 17: 36,965,050 probably benign Het
Other mutations in Stard8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Stard8 APN X 99069335 missense probably damaging 1.00
IGL01063:Stard8 APN X 99073088 missense probably damaging 1.00
FR4304:Stard8 UTSW X 99066505 unclassified probably benign
FR4976:Stard8 UTSW X 99066513 unclassified probably benign
FR4976:Stard8 UTSW X 99066525 unclassified probably benign
R4198:Stard8 UTSW X 99066508 unclassified probably benign
R4641:Stard8 UTSW X 99066508 unclassified probably benign
R8246:Stard8 UTSW X 99065964 missense probably benign
R8247:Stard8 UTSW X 99065964 missense probably benign
RF002:Stard8 UTSW X 99066515 nonsense probably null
RF010:Stard8 UTSW X 99066517 unclassified probably benign
RF043:Stard8 UTSW X 99066520 unclassified probably benign
RF043:Stard8 UTSW X 99066527 unclassified probably benign
RF051:Stard8 UTSW X 99066524 unclassified probably benign
RF055:Stard8 UTSW X 99066520 unclassified probably benign
RF063:Stard8 UTSW X 99066524 nonsense probably null
X0004:Stard8 UTSW X 99066683 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TATACAGGCTGAAGCTGAGGC -3'
(R):5'- TGGCTCTGCAGTCGAGTTAG -3'

Sequencing Primer
(F):5'- GCTGAGGCTGAAGCTGAG -3'
(R):5'- TCAGCCTGTACCAATGGTTCGAC -3'
Posted On2019-12-04