Incidental Mutation 'R7458:Dnajc10'
ID605512
Institutional Source Beutler Lab
Gene Symbol Dnajc10
Ensembl Gene ENSMUSG00000027006
Gene NameDnaJ heat shock protein family (Hsp40) member C10
SynonymsJPDI, ERdj5, D2Ertd706e, 1200006L06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location80315466-80354043 bp(+) (GRCm38)
Type of Mutationsplice site (8 bp from exon)
DNA Base Change (assembly) T to A at 80324750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028392]
PDB Structure
Crystal structure of full-length ERdj5 [X-RAY DIFFRACTION]
Crystal structure of J-Trx1 fragment of ERdj5 [X-RAY DIFFRACTION]
Crystal structure of Trx4 domain of ERdj5 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000028392
SMART Domains Protein: ENSMUSP00000028392
Gene: ENSMUSG00000027006

DomainStartEndE-ValueType
DnaJ 34 92 9.73e-26 SMART
Pfam:Thioredoxin 130 232 5.6e-21 PFAM
low complexity region 384 392 N/A INTRINSIC
Pfam:Thioredoxin 454 553 2.3e-21 PFAM
Pfam:Thioredoxin 557 663 2e-21 PFAM
Pfam:Thioredoxin 672 776 5.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum co-chaperone which is part of the endoplasmic reticulum-associated degradation complex involved in recognizing and degrading misfolded proteins. The encoded protein reduces incorrect disulfide bonds in misfolded glycoproteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased endoplasmic reticulum stress in the salivary gland. Female homozygous mutant mice are smaller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Dnajc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Dnajc10 APN 2 80324752 splice site probably benign
IGL01420:Dnajc10 APN 2 80345023 missense possibly damaging 0.81
IGL01466:Dnajc10 APN 2 80321287 missense probably benign 0.00
IGL01645:Dnajc10 APN 2 80340527 missense possibly damaging 0.46
IGL01929:Dnajc10 APN 2 80328076 missense probably damaging 0.99
IGL01958:Dnajc10 APN 2 80321304 splice site probably benign
IGL02205:Dnajc10 APN 2 80349358 missense possibly damaging 0.74
IGL02289:Dnajc10 APN 2 80340526 missense probably damaging 0.98
IGL02661:Dnajc10 APN 2 80326740 splice site probably benign
IGL02865:Dnajc10 APN 2 80331303 missense probably benign
IGL03026:Dnajc10 APN 2 80349303 missense probably damaging 0.96
IGL03407:Dnajc10 APN 2 80346641 missense probably damaging 1.00
PIT4283001:Dnajc10 UTSW 2 80331395 missense probably benign 0.19
R0092:Dnajc10 UTSW 2 80325682 missense probably damaging 0.97
R0457:Dnajc10 UTSW 2 80344946 missense possibly damaging 0.65
R1414:Dnajc10 UTSW 2 80347677 missense probably damaging 0.99
R1739:Dnajc10 UTSW 2 80347662 missense probably benign 0.03
R2126:Dnajc10 UTSW 2 80350734 critical splice donor site probably null
R3717:Dnajc10 UTSW 2 80324745 splice site probably benign
R3718:Dnajc10 UTSW 2 80324745 splice site probably benign
R4020:Dnajc10 UTSW 2 80344952 missense probably damaging 1.00
R4453:Dnajc10 UTSW 2 80346623 missense probably damaging 0.98
R4585:Dnajc10 UTSW 2 80347778 missense probably damaging 1.00
R4586:Dnajc10 UTSW 2 80347778 missense probably damaging 1.00
R4772:Dnajc10 UTSW 2 80340526 missense probably damaging 0.98
R5653:Dnajc10 UTSW 2 80349368 missense probably damaging 1.00
R6157:Dnajc10 UTSW 2 80317391 start gained probably benign
R6263:Dnajc10 UTSW 2 80343948 missense probably damaging 1.00
R6303:Dnajc10 UTSW 2 80350664 missense probably benign 0.07
R6932:Dnajc10 UTSW 2 80331336 missense probably benign
R7104:Dnajc10 UTSW 2 80340815 missense probably damaging 1.00
R7181:Dnajc10 UTSW 2 80319243 nonsense probably null
R7842:Dnajc10 UTSW 2 80345065 missense probably benign 0.04
R7925:Dnajc10 UTSW 2 80345065 missense probably benign 0.04
X0018:Dnajc10 UTSW 2 80350674 missense probably damaging 0.97
X0024:Dnajc10 UTSW 2 80344962 missense probably benign 0.19
Z1177:Dnajc10 UTSW 2 80319233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGTGAACTATTTAGGACTG -3'
(R):5'- CAGCTCCGATTCGAAGCAAC -3'

Sequencing Primer
(F):5'- TGCTGTCAACTCTGGAGA -3'
(R):5'- TAGCAAATTCTCTCCACTATGACAG -3'
Posted On2019-12-09